#1 | tempiSs. | 115,530 |
#2 | isinho | 87,742 |
#3 | Duck | 86,582 |
#4 | Sauce's | 86,127 |
#5 | Grief. | 77,147 |
#6 | ballsaq | 72,542 |
#7 | xXHerobrine_GamingXx | 66,018 |
#8 | Papiii (U.C.B.R) | 60,922 |
#9 | |#♡v♡#| | 59,891 |
#10 | Ykrothelord | 58,730 |
#11 | neymardotrickstab123 | 54,947 |
#12 | Fsnakek | 54,608 |
#13 | Dummy | 51,116 |
#14 | yokai | 49,959 |
#15 | Crow | 49,591 |
#16 | medic | 46,630 |
#17 | seg | 45,811 |
#18 | Albedo | 45,265 |
#19 | bahbé | 44,027 |
#20 | Jouissance Sadomatico | 42,866 |
#21 | sir | 42,210 |
#22 | p✰ horizon | 41,403 |
#23 | Ronaldo Cosseno | 41,091 |
#24 | ✦ | 40,322 |
#25 | ShepardWhovian | 40,320 |
#26 | worm | 36,908 |
#27 | mista lova lova | 35,195 |
#28 | gordon freeman | 34,740 |
#29 | J.P | 34,355 |
#30 | The Greatest | 33,961 |
#31 | Dispenser Gaming!!! | 33,403 |
#32 | Vitoria | 33,067 |
#33 | Only | 32,981 |
#34 | Mo Xuan | 32,338 |
#35 | Ray Foster | 30,874 |
#36 | shawn | 29,978 |
#37 | molti ☯(囲ぱ雲 | 29,211 |
#38 | SPARTANS Nesc ✠ | 28,225 |
#39 | El señor de la noche | 27,820 |
#40 | Diavolo | 27,760 |
#41 | daw | 26,267 |
#42 | Açaí | 25,490 |
#43 | Romdara. | 24,949 |
#44 | EO RICO | 23,573 |
#45 | Disillusioned Methadone scumbag | 22,987 |
#46 | pelado powerlifter | 22,730 |
#47 | Magrão | 22,302 |
#48 | fne | 22,197 |
#49 | NeverBeenSeen | 22,005 |
#50 | Spy amongus | 21,968 |
#51 | Chocotone_Voador | 21,133 |
#52 | marcy | 20,994 |
#53 | Pronóxius de Macaé | 20,506 |
#54 | oBarosa | 20,066 |
#55 | Hesoyam | 20,014 |
#56 | confia na habilidade po | 19,988 |
#57 | padaria sexo gay | 19,821 |
#58 | tobi | 19,768 |
#59 | pee man | 19,304 |
#60 | Chronos3000 | 19,149 |
#61 | MUMU OGUN THUNDERSTRIKES YOU! | 19,094 |
#62 | akiles721 | 18,831 |
#63 | boshyo | 18,403 |
#64 | Pizza | 18,338 |
#65 | miauwsss blu | 17,841 |
#66 | Exophix | 17,483 |
#67 | G0LD3N | 17,442 |
#68 | Olavo de Carvalho>Marilena Chau | 17,236 |
#69 | alba | 16,882 |
#70 | Distrito Federal | 16,620 |
#71 | lender62 | 16,449 |
#72 | Sirius 9 | 16,385 |
#73 | TIGM fase HUMO | 15,617 |
#74 | Ms. Tux | 15,190 |
#75 | Niki | 14,935 |
#76 | DRagon | 14,841 |
#77 | Assäult | 14,824 |
#78 | pot | 14,741 |
#79 | birD | 14,682 |
#80 | NicoDoido | 14,589 |
#81 | SuperFly | 14,578 |
#82 | Quack | 14,548 |
#83 | visionário76 | 14,539 |
#84 | aquatctax163 | 14,515 |
#85 | srLuiss | 14,498 |
#86 | MANÍACO #SAVETF2 | 14,305 |
#87 | apRi | 14,261 |
#88 | teddy | 13,995 |
#89 | <meta charset ="UTF-8"> | 13,977 |
#90 | Serosteem | 13,972 |
#91 | marcio herobrine | 13,969 |
#92 | Ice Pop | 13,964 |
#93 | Ricardo Ereto | 13,745 |
#94 | Cement Eater | 13,538 |
#95 | G_U | 13,223 |
#96 | Copmmer | 13,052 |
#97 | Novin | 13,052 |
#98 | Matiaz | 13,008 |
#99 | 瓜克guac⨍⨍⨍ | 13,006 |
#100 | suco de meia | 12,735 |
#101 | john yakuza | 12,588 |
#102 | ojama | 12,468 |
#103 | Fag | 12,399 |
#104 | MINI-VELHO | 12,328 |
#105 | Pistachio | 12,174 |
#106 | Stick | 12,028 |
#107 | tateu_adrianshephard | 11,865 |
#108 | Machelo | 11,837 |
#109 | caju | 11,659 |
#110 | DUQ | 11,560 |
#111 | ıןı | 11,530 |
#112 | ale | 11,430 |
#113 | happy crismas, merry chrysler ; | 11,420 |
#114 | TheMontry | 11,382 |
#115 | XO-K | 11,362 |
#116 | DogDay | 11,354 |
#117 | Arkantos | 11,269 |
#118 | arizona | 11,162 |
#119 | ghus36 | 11,097 |
#120 | Neveroddoreven | 11,069 |
#121 | Sanju Vinho e Fumaça! | 11,029 |
#122 | MetalOrd666 | 10,866 |
#123 | Gabyy | 10,856 |
#124 | one is two and three is not fiv | 10,783 |
#125 | Lyd27 | 10,476 |
#126 | orion_tharp | 10,437 |
#127 | Muru_ | 10,419 |
#128 | chamb | 10,338 |
#129 | jorgito | 10,251 |
#130 | ab1 | 10,106 |
#131 | sonia metralha | 10,082 |
#132 | P✧ RONALDO/FAQUINHA | 10,028 |
#133 | MY HEAD FUCKING HURTS!!1!!1! | 10,027 |
#134 | EdLsz | 10,024 |
#135 | Luiza | 10,015 |
#136 | Mr. Rig | 9,929 |
#137 | Pou Tático | 9,867 |
#138 | P4CKG0DWRLD2014 | 9,817 |
#139 | Poxa crush, por que não me not | 9,772 |
#140 | niko | 9,770 |
#141 | M3nt4l3xpl05i0n1!1! | 9,682 |
#142 | latero | 9,546 |
#143 | Gato | 9,452 |
#144 | Flarys | 9,398 |
#145 | kwmudu | 9,359 |
#146 | Neeeeeeeeeeeeeeeeeeeecro | 9,207 |
#147 | danielmolho | 9,118 |
#148 | imacrowbar | 9,080 |
#149 | yKG | 8,961 |
#150 | MouseDescaralhado | 8,877 |
#151 | kunah | 8,824 |
#152 | Fumaça | 8,727 |
#153 | cornetto | 8,679 |
#154 | sportingbet da silva | 8,619 |
#155 | Jack Astro | 8,584 |
#156 | White | 8,466 |
#157 | scrunchy! | 8,435 |
#158 | skele | 8,335 |
#159 | Gugs1504 | 8,154 |
#160 | PootisBR | 8,125 |
#161 | BSGmpls | 8,122 |
#162 | vito. | 8,041 |
#163 | RNGenie | 8,038 |
#164 | rokboii | 7,969 |
#165 | seamybloo | 7,931 |
#166 | Doubt | 7,906 |
#167 | argen | 7,904 |
#168 | ArtRC_13 | 7,900 |
#169 | The Tower. | 7,849 |
#170 | pinguimMELÃO | 7,801 |
#171 | ESTORAVASOS44 | 7,788 |
#172 | MC Yoshi | 7,768 |
#173 | Duckel | 7,699 |
#174 | Scourage | 7,684 |
#175 | o pedro | 7,674 |
#176 | Lynch | 7,489 |
#177 | gabagool | 7,469 |
#178 | Marmo >_ | 7,383 |
#179 | dont talk to me | 7,259 |
#180 | halls preto no cu | 7,256 |
#181 | Europa | 7,078 |
#182 | ROD631 | 7,064 |
#183 | CS.PRO Chupingole | 7,035 |
#184 | KarBun | 7,021 |
#185 | SPARTANS F3 | 6,969 |
#186 | Perfluorocarbono | 6,910 |
#187 | M<iGG | 6,870 |
#188 | SememVolante | 6,841 |
#189 | Adolf Dripler | 6,771 |
#190 | monge | 6,757 |
#191 | GG | 6,672 |
#192 | Sujiro kimimame | 6,642 |
#193 | jr_ | 6,641 |
#194 | The Shoveler | 6,622 |
#195 | Bomty 123 | 6,554 |
#196 | Fleckes | 6,518 |
#197 | BruceTheTyrant | 6,514 |
#198 | k|Mp|n | 6,492 |
#199 | VanessaMS | 6,354 |
#200 | carro desgovernado mata 3 | 6,328 |
#201 | Gabrius | 6,266 |
#202 | ABNER | 6,213 |
#203 | Meeep210 | 6,199 |
#204 | Rdesssh | 6,166 |
#205 | triste | 6,082 |
#206 | cheddar | 6,065 |
#207 | Dirk Strider | 6,002 |
#208 | andre | 5,947 |
#209 | el pichulon456 | 5,937 |
#210 | Autistic extroverted emo. | 5,929 |
#211 | orbking | 5,915 |
#212 | Squidward Tennis Balls | 5,882 |
#213 | Engineer | 5,787 |
#214 | Rodiz_ | 5,776 |
#215 | un fracasado mas | 5,734 |
#216 | Now needed | 5,728 |
#217 | MATRIX | 5,676 |
#218 | Retardadmas | 5,587 |
#219 | Blank | 5,579 |
#220 | Duck :P | 5,574 |
#221 | tulinson | 5,569 |
#222 | siririca e games | 5,562 |
#223 | ozzy | 5,552 |
#224 | portão | 5,519 |
#225 | ER | 5,517 |
#226 | Michael | 5,488 |
#227 | Dean | 5,423 |
#228 | Engenhero Calvo | 5,402 |
#229 | Giovanni McHeneg | 5,384 |
#230 | OBRIGADO CLT! | 5,373 |
#231 | Ram Ranch's Cowboy | 5,357 |
#232 | PurplaBlu | 5,353 |
#233 | NOME INCRIVEL | 5,300 |
#234 | yogurt MODO ACEITUNA | 5,230 |
#235 | Sancho | 5,211 |
#236 | TerranMarine | 5,164 |
#237 | Thrackerzod | 5,154 |
#238 | ramineko.exe | 5,138 |
#239 | nandos | 5,129 |
#240 | Toxic | 5,114 |
#241 | Araujo λ | 5,112 |
#242 | Dom.Nobre | 5,108 |
#243 | vini | 5,092 |
#244 | Dingleberry | 5,069 |
#245 | Medicanot | 5,051 |
#246 | Newgrounds2.com | 5,051 |
#247 | Corvato | 5,051 |
#248 | Pneumonoultramicroscopicsilicov | 5,043 |
#249 | Sono | 5,028 |
#250 | Note | 5,020 |
#251 | O Pagador do aluguel | 5,007 |
#252 | $r. Hello There | 4,996 |
#253 | netoespacial | 4,959 |
#254 | SEAN | 4,948 |
#255 | elohim | 4,928 |
#256 | PirateMon | 4,919 |
#257 | Karura | 4,914 |
#258 | THE OOL | 4,859 |
#259 | blah | 4,830 |
#260 | RunningHarumi | 4,770 |
#261 | Sanches | 4,748 |
#262 | B-Man | 4,744 |
#263 | AtUm | 4,727 |
#264 | est4tica | 4,713 |
#265 | ZerOne1 | 4,700 |
#266 | Tab | 4,650 |
#267 | RayanfhoulaBR | 4,642 |
#268 | Mathiasma | 4,639 |
#269 | Scout | 4,600 |
#270 | WFNX | 4,549 |
#271 | twitch.tv/yokiinno | 4,523 |
#272 | fgsfds | 4,499 |
#273 | ᴜᴢᴢɪᴇʟ | 4,470 |
#274 | 01 p✰ | 4,457 |
#275 | Zero | 4,436 |
#276 | Player_aleatorio24 | 4,432 |
#277 | black_vth | 4,419 |
#278 | ALpHa | 4,405 |
#279 | Putis | 4,396 |
#280 | Rabicó | 4,389 |
#281 | Dr. Mousebites | 4,379 |
#282 | cat suit | 4,349 |
#283 | NFunchal | 4,347 |
#284 | Karuro20 | 4,316 |
#285 | Adrian Shephard | 4,307 |
#286 | GaGmadafaka | 4,276 |
#287 | niño | 4,269 |
#288 | Safalid | 4,264 |
#289 | MR CLICKER | 4,250 |
#290 | PepsiMan | 4,220 |
#291 | Pruprula | 4,200 |
#292 | Left | 4,171 |
#293 | spork_gaming | 4,161 |
#294 | cold | 4,148 |
#295 | manuelemilmella | 4,138 |
#296 | angler | 4,137 |
#297 | Lasaña de Carne | 4,132 |
#298 | chofa | 4,118 |
#299 | kaiser | 4,106 |
#300 | dozer | 4,076 |
#301 | Gibus (Rei do Bodyshot) | 4,072 |
#302 | joaoivomogu | 4,070 |
#303 | camomille ♥ | 4,043 |
#304 | P-cring | 4,036 |
#305 | Paztelcomcana_ofc | 4,035 |
#306 | TheTopGunnerXD | 4,032 |
#307 | Marco_LOL | 4,009 |
#308 | [CHMP] Vitao Balinhas | 4,009 |
#309 | radiusculling | 4,007 |
#310 | Vinão | 4,000 |
#311 | saint | 3,984 |
#312 | Smitty Werbenjägermanjensen | 3,983 |
#313 | fffffffffffffffffffffffffffffff | 3,972 |
#314 | UzaFart :p | 3,957 |
#315 | Huskyˢᶜᶜᵖ | 3,951 |
#316 | gordo bugs | 3,904 |
#317 | Xyzdren | 3,896 |
#318 | torsofuck | 3,845 |
#319 | krow ∆Θ | 3,835 |
#320 | kaii | 3,834 |
#321 | Bisteca Lyubov | 3,833 |
#322 | Jetstream Phoenix | 3,811 |
#323 | janessalaquishashandrafeenada | 3,798 |
#324 | CALOR DA PORRA | 3,796 |
#325 | Kimber | 3,782 |
#326 | Box | 3,772 |
#327 | Yasuho | 3,768 |
#328 | Ashley | 3,759 |
#329 | The Hard | 3,759 |
#330 | pablofernandez2007 | 3,715 |
#331 | The Diddler | 3,691 |
#332 | MattBny | 3,673 |
#333 | Ladroxer | 3,664 |
#334 | bong | 3,651 |
#335 | ✿ gadlle ✿ | 3,650 |
#336 | Metal Sonic | 3,636 |
#337 | firebatz55 | 3,628 |
#338 | Calisto | 3,607 |
#339 | christiner60 | 3,600 |
#340 | STUG III(DESTROYER OF NOOBS) | 3,595 |
#341 | supahniga33 | 3,587 |
#342 | TheMorning_Light | 3,581 |
#343 | Takamassa Nomuro | 3,573 |
#344 | YaCoTh | 3,556 |
#345 | Willoper | 3,552 |
#346 | Seda-Demorada | 3,551 |
#347 | davidzaptar08 | 3,543 |
#348 | Velunkk | 3,541 |
#349 | NickGamer_07 | 3,540 |
#350 | cau | 3,533 |
#351 | Yate | 3,532 |
#352 | Poliwrath | 3,521 |
#353 | Cuenta1424 | 3,512 |
#354 | DESTROYER OF WORLDS | 3,467 |
#355 | Narty do Xablau | 3,463 |
#356 | heavy | 3,430 |
#357 | Hrerklamerkalarkersaf | 3,429 |
#358 | Ledif Zetineb | 3,414 |
#359 | demoknight main | 3,406 |
#360 | gatzbee | 3,367 |
#361 | straight out of a cartoon | 3,365 |
#362 | juro q n xito (dedos cruzados) | 3,351 |
#363 | o bananastico banana | 3,335 |
#364 | C O Y A | 3,335 |
#365 | pipo | 3,333 |
#366 | Tom | 3,332 |
#367 | Epic Face | 3,324 |
#368 | TintaGuaxi | 3,320 |
#369 | gurrumin | 3,310 |
#370 | Sandvich Dispenser | 3,308 |
#371 | heso-meno | 3,290 |
#372 | SpyCrab #VirgenMain ᗜ˰ᗜ | 3,240 |
#373 | MCquattro.69 | 3,237 |
#374 | Duardo | 3,232 |
#375 | joao | 3,229 |
#376 | Just Digifam | 3,223 |
#377 | Jalinn Chibata | 3,219 |
#378 | scram | 3,214 |
#379 | o tecnico sumiu com meu pc | 3,213 |
#380 | sairdaniel | 3,206 |
#381 | Tomásthegamer | 3,199 |
#382 | miranda | 3,192 |
#383 | Power Of E | 3,191 |
#384 | blame john | 3,181 |
#385 | lucyyy ★♡★ paçoquita | 3,176 |
#386 | sou raiz ainda? | 3,164 |
#387 | Cadeira do Datena | 3,158 |
#388 | igor | 3,156 |
#389 | Filhote | 3,149 |
#390 | HENRIQUE.T | 3,140 |
#391 | Hombre D | 3,137 |
#392 | neguinho no XBOX | 3,127 |
#393 | Angel Gabs | 3,125 |
#394 | SnK | Snakes and Knives | 3,114 |
#395 | BloodNGuts | 3,109 |
#396 | zeca gado | 3,106 |
#397 | Vanilla Cake | 3,104 |
#398 | warmou | 3,066 |
#399 | 12v | 3,059 |
#400 | natocmp | 3,058 |
#401 | Só jogo de trolldier! | 3,058 |
#402 | Evryt | 3,051 |
#403 | tu mama | 3,051 |
#404 | ____ | 3,043 |
#405 | Sandvich #UnmuteF2P | 3,042 |
#406 | mMeEzOiIdE | 3,041 |
#407 | SIDNEY [HE/THEY/HER] | 3,032 |
#408 | [[Hyperlink Blocked]] | 3,031 |
#409 | CanDieVon | 3,030 |
#410 | The Duck | 3,029 |
#411 | Pog | 3,023 |
#412 | Juan God | 3,011 |
#413 | TurboMann2263 | 3,009 |
#414 | ozy | 3,003 |
#415 | effembee | 2,990 |
#416 | nopez | 2,986 |
#417 | Endereço_Gueimer | 2,977 |
#418 | Runic | 2,959 |
#419 | MauricioGmod | 2,957 |
#420 | Havish | 2,957 |
#421 | MaoZedong | 2,936 |
#422 | Terra | 2,927 |
#423 | 76375#WendaVirginMain | 2,923 |
#424 | Laggy Niks | 2,922 |
#425 | talesprock | 2,920 |
#426 | @STR Darkmanpro071 | 2,919 |
#427 | jao | 2,915 |
#428 | metacros2d | 2,910 |
#429 | ❥Ⓚⓦⓘⓟⓐⓥⓔ♥❤ | 2,876 |
#430 | NoNamed 2 | 2,866 |
#431 | xXMr. PriceXx | 2,863 |
#432 | @abn | 2,847 |
#433 | ._. | 2,838 |
#434 | craftingcreeper666 | 2,831 |
#435 | Ryuuji | 2,811 |
#436 | Tekko | 2,810 |
#437 | RafasDr | 2,801 |
#438 | AG thomy | 2,795 |
#439 | luke | 2,793 |
#440 | Pluck | 2,788 |
#441 | Reinhardt | 2,763 |
#442 | rock paper scissor master | 2,760 |
#443 | 7Up | 2,756 |
#444 | nosk | 2,748 |
#445 | john | 2,743 |
#446 | neymar junior games | 2,742 |
#447 | DogmaEnigma | 2,713 |
#448 | < blank > | 2,702 |
#449 | Scoungo cat | 2,701 |
#450 | my tummy hurts | 2,701 |
#451 | Nathema | 2,695 |
#452 | Madeline | 2,689 |
#453 | drodo -II- | 2,677 |
#454 | Revynax | 2,674 |
#455 | MrVenom935 | 2,661 |
#456 | FwuffyKittens | 2,655 |
#457 | deidadtromer | 2,655 |
#458 | sallie5991 | 2,652 |
#459 | lion | 2,647 |
#460 | edubatebe | 2,646 |
#461 | N | 2,641 |
#462 | SPIKED | 2,634 |
#463 | Miguelopo | 2,633 |
#464 | SatoSoul1 | 2,633 |
#465 | deeja | 2,632 |
#466 | efervescência intergaláctica | 2,628 |
#467 | Cryptonium90 | 2,622 |
#468 | Sock | 2,621 |
#469 | bob | 2,620 |
#470 | 13r4him | 2,619 |
#471 | Lucas oooooo | 2,612 |
#472 | worldsworstspacemarine2player | 2,593 |
#473 | Spyackaso Spyu | 2,590 |
#474 | I hate Sudiak | 2,584 |
#475 | Francix | 2,582 |
#476 | muri | 2,582 |
#477 | leking_dedode | 2,565 |
#478 | Domado por un f2p | 2,556 |
#479 | deaf | 2,555 |
#480 | BASURA ACUÁTICA | 2,542 |
#481 | gameswithmigay | 2,540 |
#482 | Carnerinho | 2,540 |
#483 | gatokl_perkin43 | 2,534 |
#484 | Chai | 2,534 |
#485 | Allan_G | 2,531 |
#486 | OddyTheBastard | 2,527 |
#487 | LucxThePro | 2,523 |
#488 | SlickMcClick | 2,516 |
#489 | Jay Jay, o Jatinho | 2,515 |
#490 | bicho do mato | 2,510 |
#491 | Dorsal fin | 2,508 |
#492 | GAÚCHO GOSTOSO | 2,502 |
#493 | Gourmand | 2,499 |
#494 | Danki974 | 2,495 |
#495 | fruitsplat | 2,489 |
#496 | luizkw | 2,454 |
#497 | Kyle909 | 2,451 |
#498 | Señor Humor | 2,446 |
#499 | Raviosa | 2,445 |
#500 | Torengi | 2,441 |
#501 | Twitch/Delujjo | 2,438 |
#502 | Batu_Khan | 2,437 |
#503 | jackodile42 | 2,415 |
#504 | Clayton Goiaba | 2,412 |
#505 | Isaac_27 | 2,412 |
#506 | Demon | 2,407 |
#507 | DELETE DELETE DELETE | 2,403 |
#508 | tr4sh | 2,402 |
#509 | YoCarter | 2,399 |
#510 | cringe | 2,388 |
#511 | ʟᴀɴɪᴀᴋᴇᴀ | 2,386 |
#512 | Derretimento Geral 2017 | 2,383 |
#513 | victor gamer | 2,380 |
#514 | darkjjulio | 2,380 |
#515 | Lyric | 2,379 |
#516 | frango frito | 2,375 |
#517 | Thumbalina | 2,373 |
#518 | jooce | 2,369 |
#519 | TeuPaiComeuTuaMãe | 2,359 |
#520 | A-posing Demo | 2,351 |
#521 | dawson | 2,344 |
#522 | elgato | 2,335 |
#523 | sixworld | 2,325 |
#524 | Dynamic | 2,310 |
#525 | Esqueleto | 2,306 |
#526 | The "New" | 2,301 |
#527 | Jojo Madruga | 2,301 |
#528 | twizinho | 2,301 |
#529 | Moura | 2,296 |
#530 | Maik | 2,290 |
#531 | horizZzona | 2,282 |
#532 | Hugo | 2,272 |
#533 | Hex | 2,272 |
#534 | jose003 | 2,272 |
#535 | Scottish John | 2,263 |
#536 | Windows 7 WHOPPER | 2,256 |
#537 | Denzel | 2,250 |
#538 | MENTALLY INSANE | 2,250 |
#539 | dewdrop | 2,248 |
#540 | OlimpioM | 2,246 |
#541 | mstrazdins14 | 2,241 |
#542 | Nickzera | 2,227 |
#543 | floresadorables | 2,224 |
#544 | Doug33 | 2,222 |
#545 | PabloV | 2,215 |
#546 | Joseph | 2,195 |
#547 | discoh | 2,182 |
#548 | Psychotic Duck | 2,179 |
#549 | Grandes Árvores | 2,177 |
#550 | fatty-bear | 2,175 |
#551 | La Ranarda | 2,175 |
#552 | nammy | 2,165 |
#553 | NotSoTallHamster | 2,163 |
#554 | ewuska_6 | 2,145 |
#555 | Cabeça de baleia desfigurada | 2,135 |
#556 | Vanildo | 2,134 |
#557 | POPEYE EL MARINO | 2,133 |
#558 | Waffle Witch | 2,130 |
#559 | Medic | 2,130 |
#560 | Miki | 2,129 |
#561 | Foolery, Tom | 2,125 |
#562 | saper | 2,123 |
#563 | Cikre | 2,115 |
#564 | Lestibournes | 2,106 |
#565 | Irritatedcheese | 2,106 |
#566 | Abobiback | 2,104 |
#567 | joke #funny | 2,103 |
#568 | Oi | 2,103 |
#569 | Luce | 2,094 |
#570 | DarkMagiGirl | 2,092 |
#571 | Serprai | 2,081 |
#572 | Crow Mauler from F&H | 2,074 |
#573 | Anon | 2,073 |
#574 | Somatic | 2,072 |
#575 | f2p vini | 2,072 |
#576 | CLOVI | 2,071 |
#577 | ont | 2,070 |
#578 | wrtls | 2,066 |
#579 | Soldier-maconheiro | 2,063 |
#580 | vitorfs20004 | 2,062 |
#581 | UMV | 2,060 |
#582 | benjamín | 2,046 |
#583 | JakeTheSnake | 2,044 |
#584 | pehmos Hatsune Miku enjoyer | 2,040 |
#585 | pootis | 2,040 |
#586 | Jingle.Ligma | 2,039 |
#587 | SrGalleta | 2,037 |
#588 | <=={Ares}===]---0 | 2,031 |
#589 | Flopp The Klown | 2,024 |
#590 | Mucha Lucha | 2,019 |
#591 | Fry | 2,014 |
#592 | Bob toronja azerbaijani | 2,010 |
#593 | dashlet | 2,006 |
#594 | Arbokk | 1,988 |
#595 | Dr. Deutschmark | 1,987 |
#596 | hiro ☯ maconheiro fantasma | 1,972 |
#597 | xX_TongoVéio_Xx | 1,966 |
#598 | joaolucas.bressan.com.br | 1,963 |
#599 | Herr Doctor | 1,953 |
#600 | Gibus Spy | 1,950 |
#601 | Mr. Morale & The Soap Eaters | 1,947 |
#602 | thepartydude6 | 1,932 |
#603 | Flowkami | 1,923 |
#604 | Queen Elizabett | 1,922 |
#605 | Mouse | 1,913 |
#606 | M0onXy3 | 1,910 |
#607 | CRITIQUI | 1,906 |
#608 | αlfie | 1,904 |
#609 | viraemia | 1,899 |
#610 | Abex | 1,896 |
#611 | Pistoleiro(GOD) | 1,893 |
#612 | grm | 1,891 |
#613 | joe | 1,878 |
#614 | esqueleto | 1,877 |
#615 | 「 Kynon 」 | 1,867 |
#616 | wamfkls | 1,866 |
#617 | Non-sense | 1,857 |
#618 | sant1 | 1,846 |
#619 | General embaixadinha | 1,843 |
#620 | finnysalty123 | 1,842 |
#621 | average friendly heavy | 1,840 |
#622 | DECO | 1,839 |
#623 | Aguzlob | 1,838 |
#624 | NicolasGH ツ | 1,838 |
#625 | v: | 1,830 |
#626 | tonky_pneu | 1,824 |
#627 | doge | 1,820 |
#628 | dimitri111 | 1,815 |
#629 | Jasão | 1,813 |
#630 | Evelyyn (amo mulheres) | 1,809 |
#631 | MDG| Blindsinner | 1,809 |
#632 | Salty Bubble | 1,802 |
#633 | Mudin | 1,801 |
#634 | ★calopsita ★ | 1,796 |
#635 | The Tickle | 1,793 |
#636 | xX_vitaogeme2007_Xx | 1,782 |
#637 | percguu | 1,778 |
#638 | just a lil bro | 1,777 |
#639 | victorbbbk12 BR | 1,774 |
#640 | V1 [TUPS] | 1,771 |
#641 | MIRANDA | 1,770 |
#642 | Lhyntel | 1,766 |
#643 | BRONZEIRO | 1,764 |
#644 | Meekers | 1,752 |
#645 | Lambie | 1,750 |
#646 | 11bee | 1,744 |
#647 | Fusion_scythe | 1,737 |
#648 | ped | 1,734 |
#649 | VM | 1,733 |
#650 | ‹3 | 1,713 |
#651 | SrArence | 1,713 |
#652 | Brian :] | 1,712 |
#653 | Vicenteman46 | 1,711 |
#654 | Avery_the_Furry_Dragon | 1,709 |
#655 | djscrewface | 1,705 |
#656 | pex | 1,704 |
#657 | Valentim, o Valente | 1,704 |
#658 | LuizVinicius17 | 1,696 |
#659 | Jotaro kirby | 1,689 |
#660 | Exodus | 1,688 |
#661 | jesus.lover2001 | 1,681 |
#662 | Hiolld | 1,677 |
#663 | reddy | 1,674 |
#664 | minion gore addiction | 1,673 |
#665 | Pinguu™ | 1,670 |
#666 | jow | 1,664 |
#667 | Leonardo_0.0 | 1,664 |
#668 | espinhos duro | 1,663 |
#669 | 0zai Ω | 1,662 |
#670 | Sarcast1c Kiyn | 1,659 |
#671 | ekboy2008 | 1,644 |
#672 | Cλbo | 1,643 |
#673 | Prisma Negativo | 1,642 |
#674 | Bucketboi | 1,642 |
#675 | CrackedSanity | 1,640 |
#676 | Karbob | 1,638 |
#677 | parlocafss. | 1,632 |
#678 | Rafaelcsx | 1,631 |
#679 | Juan Mecanico | 1,625 |
#680 | EL_CHICHICUILOTE | 1,614 |
#681 | ALBERTO | 1,610 |
#682 | JAVIER PANCITO BIMBO MASCHERANO | 1,609 |
#683 | malles | 1,604 |
#684 | ECCHI | 1,603 |
#685 | SUPERraTIX- Teto Enthusiast | 1,602 |
#686 | Dudu | 1,598 |
#687 | Clubs | 1,596 |
#688 | Javaris Jamar Javarison-Lamar | 1,595 |
#689 | zCHAMPZ | 1,593 |
#690 | casuario. | 1,589 |
#691 | opposing horse | 1,586 |
#692 | tim4ik1601 | 1,582 |
#693 | The GREAT Goose | 1,580 |
#694 | Kizeff | 1,577 |
#695 | arca1ne | 1,576 |
#696 | guitarr31 | 1,574 |
#697 | w u t | 1,571 |
#698 | Scooter McCooter | 1,569 |
#699 | Maths | 1,569 |
#700 | Cherry | 1,567 |
#701 | Comprando-> Keys (1700AR$) | 1,564 |
#702 | PorraSecaEDura | 1,564 |
#703 | zeniga | 1,561 |
#704 | The | 1,559 |
#705 | insane | 1,556 |
#706 | Detetive Engineer | 1,550 |
#707 | Plutonium-239 | 1,548 |
#708 | Gu | 1,548 |
#709 | ZNiko | 1,545 |
#710 | «AstelDev» | 1,537 |
#711 | أنت في وعائية | 1,535 |
#712 | Spywagen | 1,533 |
#713 | Nelipe Feto | 1,531 |
#714 | rip_dark | 1,530 |
#715 | Tarma | 1,528 |
#716 | Doktor Avalanche | 1,527 |
#717 | yosh.wav | 1,523 |
#718 | Kiko._. | 1,522 |
#719 | Jeremy | 1,520 |
#720 | krassY | 1,519 |
#721 | Notorious Drunk | 1,513 |
#722 | FOPS | 1,512 |
#723 | hector.uzumaki1997 | 1,502 |
#724 | NyQuil Gel Caps | 1,498 |
#725 | gambas | 1,497 |
#726 | Argentina 4 - Brasil 1 | 1,493 |
#727 | Golpe Baixo | 1,490 |
#728 | Drain | 1,488 |
#729 | cannibalgirl666 | 1,478 |
#730 | Thedestroyerofworlds09123 | 1,478 |
#731 | KingCold | 1,478 |
#732 | Crazy Dave pra mim é só Dave | 1,477 |
#733 | ? | 1,477 |
#734 | Gabriel | 1,475 |
#735 | roberto gamer sigma moggador | 1,473 |
#736 | Grave†en_FVT | 1,470 |
#737 | Pamuri | 1,468 |
#738 | NgTv' | 1,464 |
#739 | ebananapeelgaming | 1,449 |
#740 | Feesh_gaming3 | 1,448 |
#741 | Fainty | 1,446 |
#742 | Runnin' with the Devil | 1,441 |
#743 | shadow | 1,441 |
#744 | Felts | 1,434 |
#745 | Jemmet | 1,433 |
#746 | Yatogami | 1,428 |
#747 | ThiccThighsSaveLives_9 | 1,428 |
#748 | nick'-' | 1,423 |
#749 | Darkito. | 1,415 |
#750 | o Scouteiro (F2P) | 1,415 |
#751 | bap | 1,412 |
#752 | 03 | 1,408 |
#753 | Tetoris (not tetris) | 1,403 |
#754 | 『Please, Call me Doku』 | 1,392 |
#755 | lucianoeduardooliveiraneves | 1,391 |
#756 | XK | 1,389 |
#757 | Ponpoko | 1,385 |
#758 | Facu | 1,383 |
#759 | raw | 1,380 |
#760 | moon. | 1,380 |
#761 | friv_jogos2.com o inimigo agora | 1,379 |
#762 | Lizzie | 1,379 |
#763 | Atachedel | 1,378 |
#764 | Knyte | 1,378 |
#765 | ◢︎ htm_34 | 1,376 |
#766 | Bruses | 1,373 |
#767 | Agent Monke | 1,373 |
#768 | laranja | 1,373 |
#769 | Sandvich Dispenser | 1,369 |
#770 | gunhundred91 | 1,368 |
#771 | Rezl_RR | 1,368 |
#772 | ♥ Stoned Femboy #w# ♥ | 1,367 |
#773 | renan | 1,366 |
#774 | Foca Saiyajin | 1,366 |
#775 | Unbreakable M | 1,365 |
#776 | a scalpel of your own | 1,364 |
#777 | Lunatic Lilo | 1,364 |
#778 | godofredo1465890 | 1,361 |
#779 | Animes | 1,358 |
#780 | shegy | 1,354 |
#781 | ande | 1,351 |
#782 | yes | 1,350 |
#783 | Boomie:3 | 1,348 |
#784 | yieldingsign528 | 1,344 |
#785 | huu tao | 1,343 |
#786 | IExist | 1,339 |
#787 | Malefico 2.0 ⓦ | 1,337 |
#788 | ¥™* (RATA-GAMER)*™¥ | 1,333 |
#789 | sup | 1,325 |
#790 | cu de cupim | 1,322 |
#791 | vai se f0der turnip0 | 1,322 |
#792 | Quarkchop783 | 1,322 |
#793 | Ravian | 1,319 |
#794 | ROACH - |HM| | 1,318 |
#795 | zibix333t | 1,318 |
#796 | pedromaconha | 1,317 |
#797 | Lord Wolfking | 1,317 |
#798 | elvania.marcelino | 1,315 |
#799 | Dr. Bolas Tristes | 1,314 |
#800 | biriz1n | 1,314 |
#801 | ElMattu | 1,309 |
#802 | Ricmaster | 1,305 |
#803 | blylight | 1,299 |
#804 | Orgasmus | 1,298 |
#805 | Jalapeño | 1,297 |
#806 | Femboyz>< | 1,295 |
#807 | elyanke123456 | 1,295 |
#808 | gALi | 1,294 |
#809 | dryfish | 1,289 |
#810 | GNew | 1,286 |
#811 | ruldkz | 1,286 |
#812 | novi | 1,281 |
#813 | forma legal | 1,275 |
#814 | AutumnGone18760 | 1,274 |
#815 | WaterDamagedTree | 1,274 |
#816 | infirmux | 1,270 |
#817 | Papai Dengoso | 1,269 |
#818 | GHoSTFRe4K | 1,267 |
#819 | Rei Prosciutto | 1,264 |
#820 | c6 arlecchino | 1,261 |
#821 | KoopaZ | 1,255 |
#822 | Tarlonten | 1,254 |
#823 | lucassteinhaus | 1,254 |
#824 | Fideo con tuco | 1,253 |
#825 | Peter Griffin Carlinhos | 1,252 |
#826 | my favorite peruvian | 1,250 |
#827 | riZn | 1,249 |
#828 | Leonel | 1,245 |
#829 | bombs | 1,242 |
#830 | VirgoliniSupremo! | 1,237 |
#831 | lixeira | 1,235 |
#832 | Colt Greyman | 1,234 |
#833 | capybara | 1,232 |
#834 | ™M I G U E L™ | 1,232 |
#835 | Conker Starr | 1,231 |
#836 | ꧁ঔৣ☬✞ Misha ✞☬ঔ | 1,231 |
#837 | Hotguy77 | 1,230 |
#838 | Termina | 1,229 |
#839 | broacosmica | 1,227 |
#840 | ronaldinho soccer | 1,227 |
#841 | Doc | 1,225 |
#842 | crazyboris | 1,224 |
#843 | sertcat | 1,222 |
#844 | GrX | 1,222 |
#845 | FeelProbst | 1,218 |
#846 | Lukah | 1,213 |
#847 | Eeezuz | 1,212 |
#848 | Radux Sepul | 1,210 |
#849 | FayZerk | 1,209 |
#850 | Kappu Hoshi | 1,208 |
#851 | 44* | 1,204 |
#852 | Rudzh | 1,202 |
#853 | g4bruh | 1,197 |
#854 | Dexter Morgan | 1,193 |
#855 | goofyber | 1,192 |
#856 | dnd | 1,192 |
#857 | Mago Marciano | 1,189 |
#858 | Manjapan | 1,188 |
#859 | Mr.Sunshine | 1,185 |
#860 | sordado | 1,183 |
#861 | ZUDDHA | 1,182 |
#862 | cracknalata | 1,178 |
#863 | ezren | 1,178 |
#864 | Q | 1,177 |
#865 | GogmaGaming | 1,177 |
#866 | BOB | 1,174 |
#867 | Nizzo | 1,173 |
#868 | rock porra | 1,169 |
#869 | battle | 1,169 |
#870 | box | 1,167 |
#871 | Fish | 1,167 |
#872 | racingoliveira1973 | 1,167 |
#873 | Ichi | 1,164 |
#874 | Luigi Octavio | 1,163 |
#875 | Tavo | 1,158 |
#876 | venz | 1,157 |
#877 | macterabrewclassic zeroredsugar | 1,156 |
#878 | PastelDePapa | 1,155 |
#879 | XxSCR00LxX | 1,153 |
#880 | nyoma | 1,153 |
#881 | Saiko Cringe de bem Cringe | 1,150 |
#882 | chromia | 1,149 |
#883 | ❤ Edu! ❤ | 1,146 |
#884 | ุ | 1,145 |
#885 | Kiwi² | 1,144 |
#886 | Antonio Ramon Ramon | 1,139 |
#887 | GJ | 1,137 |
#888 | marciof04 | 1,133 |
#889 | koneko | 1,133 |
#890 | augmentate | 1,133 |
#891 | Zubug10 | 1,133 |
#892 | the she in shenanigans | 1,128 |
#893 | Astro | 1,127 |
#894 | Skinny | 1,127 |
#895 | ✧Valencio24✪ ω ✪)✧ | 1,126 |
#896 | VailRoid | 1,126 |
#897 | Boczar | 1,124 |
#898 | !memide | 1,119 |
#899 | ɢᴀʙʀᴏɪʏ | 1,119 |
#900 | yacoge | 1,118 |
#901 | biel | 1,115 |
#902 | {Ta-iE} | 1,114 |
#903 | Joe Makes Children Widen Biden | 1,112 |
#904 | zod | 1,110 |
#905 | Hispanic_Mario | 1,109 |
#906 | Hyper | 1,109 |
#907 | Arthur! | 1,108 |
#908 | CT-1902 Captain Madsen | 1,105 |
#909 | Calanguim | 1,104 |
#910 | Ангел | 1,103 |
#911 | liam | 1,102 |
#912 | Aponsentado | 1,100 |
#913 | RaposaDePelúcia | 1,099 |
#914 | darkflowblade | 1,098 |
#915 | Deki | 1,096 |
#916 | BlutsaugerLover82 | 1,093 |
#917 | lowpoly | 1,089 |
#918 | T3NSHI | 1,088 |
#919 | oknilp esroh | 1,088 |
#920 | Sailor Steve | 1,087 |
#921 | EvilClown | 1,087 |
#922 | Juwu | 1,087 |
#923 | dreamtalexd | 1,082 |
#924 | engenhero gaming | 1,080 |
#925 | z D | 1,077 |
#926 | <=}-Phoenixrising-{=> | 1,075 |
#927 | MaximoPoder | 1,074 |
#928 | Jacinto | 1,072 |
#929 | Pappo | 1,071 |
#930 | Torrance, Jack | 1,070 |
#931 | Sofia | 1,070 |
#932 | Dual_cat | 1,062 |
#933 | bolygon | 1,062 |
#934 | SamTheMarsheevee | 1,060 |
#935 | Niatrossan | 1,058 |
#936 | drvzwig.jovopeek | 1,054 |
#937 | bob esponja | 1,052 |
#938 | kleber | 1,051 |
#939 | Messa | 1,050 |
#940 | Gavriil | 1,048 |
#941 | CJoshuaw | 1,045 |
#942 | o,,,,,,,,,,,,,,,,,,,,,,,,,,, | 1,044 |
#943 | pm do latuff | 1,044 |
#944 | Lefty_13 | 1,043 |
#945 | Fast Cholo | 1,038 |
#946 | geck40000wf | 1,038 |
#947 | AABattery | 1,038 |
#948 | SophiA | 1,037 |
#949 | hoovy | 1,036 |
#950 | josephthegordão.j | 1,030 |
#951 | Prime | 1,030 |
#952 | jumbanajake | 1,029 |
#953 | NocturnalWatcher | 1,028 |
#954 | francoantoniello08 | 1,024 |
#955 | Goatiplex Enterprises | 1,023 |
#956 | aaronlamulticuenta | 1,021 |
#957 | WinterGuy | 1,020 |
#958 | 800x600 | 1,016 |
#959 | The Other Dude | 1,015 |
#960 | perestroika | 1,012 |
#961 | Salute | 1,010 |
#962 | Sourdough Carl | 1,009 |
#963 | mistur_awsomnes_balls | 1,007 |
#964 | grumpycat | 1,004 |
#965 | SORATI | 1,003 |
#966 | ツ | 1,002 |
#967 | paja eterna | 995 |
#968 | Scrumpy demo gaming | 994 |
#969 | chetume | 993 |
#970 | sniper + cats | 992 |
#971 | Correia de Bicicleta | 986 |
#972 | Furrit0..- | 984 |
#973 | bunda mole | 984 |
#974 | Woderp | 983 |
#975 | HQZI | 983 |
#976 | SneezyPig | 977 |
#977 | AlpacaGaming69 | 977 |
#978 | Liamiak6 | 975 |
#979 | boo | 974 |
#980 | qwertyuiop | 973 |
#981 | DosPuntosUve | 970 |
#982 | Play_Future | 970 |
#983 | MaT〚★★★〛 | 968 |
#984 | RoboSorano | 966 |
#985 | Capochista 8++ | 966 |
#986 | Ocelotc566™ | 965 |
#987 | 60909 | 964 |
#988 | Guyzrr | 962 |
#989 | ª | 959 |
#990 | algum Zé ruela | 955 |
#991 | Martin | 954 |
#992 | Niz | 954 |
#993 | Reli | 953 |
#994 | Mario Neta | 953 |
#995 | cigarro do alek | 952 |
#996 | Central Cee | 950 |
#997 | homen-vermelho | 950 |
#998 | Spades | 949 |
#999 | Fazergast | 947 |
#1000 | MiniDrew | 947 |
#1001 | starm0nster | 944 |
#1002 | Skippy | 936 |
#1003 | Red Coelho | 934 |
#1004 | LIPE † | 933 |
#1005 | lcarlosclxx | 932 |
#1006 | dom casmurro | 927 |
#1007 | Slenderboi939 | 924 |
#1008 | Полюшка | 920 |
#1009 | Wolf Pack | 920 |
#1010 | KY6AP | 919 |
#1011 | ballz | 919 |
#1012 | Nivek | 918 |
#1013 | E AI FI BÃO | 918 |
#1014 | Pires_Alone | 918 |
#1015 | Taiwan | 917 |
#1016 | RHG | 915 |
#1017 | Rad | 915 |
#1018 | Ҝ.Ξ.F.Я™ | 915 |
#1019 | Ankha BR | 912 |
#1020 | AZNO Fan de Megadeth | 906 |
#1021 | Oliooo98 | 900 |
#1022 | treeoflifeblood | 897 |
#1023 | gonzo_33_99 | 895 |
#1024 | 5 putas 4 forros | 889 |
#1025 | MAXXTER BAITƎR (Minoman) | 887 |
#1026 | Frost | 884 |
#1027 | sneshhyfurr≧ω≦ | 883 |
#1028 | destroyersquigg | 883 |
#1029 | Mafdutra | 882 |
#1030 | creeperkid123123 | 880 |
#1031 | Monsieur Pequeño -p | 879 |
#1032 | America do RedPill | 878 |
#1033 | Hoxton | 876 |
#1034 | KaoTick | 874 |
#1035 | Dongus | 874 |
#1036 | Tyler o cara que cria os bagulh | 872 |
#1037 | cu preto games | 870 |
#1038 | KINITOPET | 870 |
#1039 | HENOOB | 868 |
#1040 | Kripi y pasta | 868 |
#1041 | Carpanola | 866 |
#1042 | Oz mac | 864 |
#1043 | Kaiserwill | 862 |
#1044 | K' | 862 |
#1045 | Vergil | 861 |
#1046 | Z the kobold | 859 |
#1047 | llllllllllllllllllllllllllll | 858 |
#1048 | ricardo12 | 856 |
#1049 | Avocado | 854 |
#1050 | ุ | 854 |
#1051 | bacc | 852 |
#1052 | wgod | 851 |
#1053 | Bacel | 850 |
#1054 | PuffinSting | 849 |
#1055 | Rap do Kakatchê | 848 |
#1056 | PORTUGAL FencY | 847 |
#1057 | suzieQ | 847 |
#1058 | [B]alls | 844 |
#1059 | mud | 842 |
#1060 | Nicole | 842 |
#1061 | manip | 838 |
#1062 | TyruZ | 837 |
#1063 | Orion | 835 |
#1064 | pppppp | 835 |
#1065 | hepboo | 834 |
#1066 | terrible | 834 |
#1067 | bob | 833 |
#1068 | v8cola | 832 |
#1069 | Dallas Payday The 3rd | 831 |
#1070 | paganistpawjob793 | 830 |
#1071 | Scattar Gunther the Second | 830 |
#1072 | J | 830 |
#1073 | Nightshade | 830 |
#1074 | Pow Pow | 830 |
#1075 | T Jester | 830 |
#1076 | Net | 829 |
#1077 | CursedKimchi | 827 |
#1078 | TheJollyOne | 826 |
#1079 | Princess Lara | 826 |
#1080 | old plankton | 824 |
#1081 | Oldmann | 823 |
#1082 | Cherriyoka ✦ | 823 |
#1083 | pretty boys make crosses | 821 |
#1084 | milk | 819 |
#1085 | gabsgol | 815 |
#1086 | SugarGlass | 812 |
#1087 | Mrs.Voice75 | 811 |
#1088 | NicoDoido | 807 |
#1089 | bread man | 807 |
#1090 | lilja | 807 |
#1091 | gonny | 806 |
#1092 | obit | 806 |
#1093 | PaharitoHostil | 805 |
#1094 | BADSORVETEAZUL | 804 |
#1095 | nisa20092011 | 803 |
#1096 | Stick | 802 |
#1097 | Pulga_Prenha | 798 |
#1098 | akakskajsjkasjasahgsahsdda | 794 |
#1099 | Phxntom | 794 |
#1100 | Fantakk | 794 |
#1101 | Desnot | 793 |
#1102 | don.zapallo.XD | 792 |
#1103 | Your average town drunk | 790 |
#1104 | corvo desgraçado | 790 |
#1105 | Lightcloud6177_tgs************* | 790 |
#1106 | dwong | 789 |
#1107 | nina | 788 |
#1108 | mi | 783 |
#1109 | mustard. | 781 |
#1110 | Gabe | 778 |
#1111 | AlfajorConTalco | 774 |
#1112 | FinnGV | 774 |
#1113 | felipitolindo18 | 772 |
#1114 | capuccino | 772 |
#1115 | Pyrrhic Evolution | 770 |
#1116 | Right-Behind-You | 770 |
#1117 | insvitalien | 767 |
#1118 | Midza | 765 |
#1119 | ⛧Reny The summoning⛧ | 762 |
#1120 | Fronzack | 762 |
#1121 | Cpt Tuna | 761 |
#1122 | El Gordo Shooter | 760 |
#1123 | lukitas_220 | 756 |
#1124 | RascalRaccoon | 755 |
#1125 | $Z!K4NØØB | 753 |
#1126 | ne | 752 |
#1127 | lisergia | 752 |
#1128 | ◄Lectro 07► | 752 |
#1129 | Clunk | 750 |
#1130 | BREAKDOWNBREAKDOWNBREAKDOWNBREA | 750 |
#1131 | BLARBZ | 749 |
#1132 | Miguel | 749 |
#1133 | Xx_Zepek_xX | 749 |
#1134 | DogeBunny | 748 |
#1135 | jny | 747 |
#1136 | I5-11400F | 746 |
#1137 | Gartron | 746 |
#1138 | mariel.crisci | 744 |
#1139 | Hidanঞ | 743 |
#1140 | WTF IS ZDRADA?!?!?!? | 742 |
#1141 | Lume | 742 |
#1142 | Wight | 741 |
#1143 | yeoldminecraft | 740 |
#1144 | Reliavl | 740 |
#1145 | Gray | 736 |
#1146 | /blank/ | 733 |
#1147 | Ghee Buttersnaps | 732 |
#1148 | Lemon 'nade | 732 |
#1149 | Robin | 730 |
#1150 | Spurrit from MSM | 728 |
#1151 | karakulovaroslav | 728 |
#1152 | Bubinoso Sábio | 727 |
#1153 | chax | 726 |
#1154 | spricvk | 724 |
#1155 | Somewhat Real. | 723 |
#1156 | Azure | 722 |
#1157 | ulices | 722 |
#1158 | ILayTheWaffle | 722 |
#1159 | myTbro! | 722 |
#1160 | CAPETA | 721 |
#1161 | yutakaa !! | 718 |
#1162 | Male_07 | 718 |
#1163 | ⭐Pedrin⭐ | 716 |
#1164 | Dutra | 716 |
#1165 | BreadCat | 716 |
#1166 | Ren98 | 715 |
#1167 | Berlim | 715 |
#1168 | mango phonk | 714 |
#1169 | Electrick_6 | 714 |
#1170 | Ghost_Force | 713 |
#1171 | John Markplier | 712 |
#1172 | Monoculus-Brother | 712 |
#1173 | Goober | 711 |
#1174 | 6.8ml of frothy cum | 710 |
#1175 | insanity | 709 |
#1176 | PB (Pateta Brazileiro) | 706 |
#1177 | fancy fish | 704 |
#1178 | dr bob | 702 |
#1179 | Latte | 700 |
#1180 | Paper Pyro | 700 |
#1181 | Mr. Backstabby | 700 |
#1182 | Shaolin Matador de Porco | 699 |
#1183 | poobles | 696 |
#1184 | batym2015 | 693 |
#1185 | monkey | 693 |
#1186 | Yazize | 688 |
#1187 | Argel | 687 |
#1188 | emga | 687 |
#1189 | MegaMonkey | 686 |
#1190 | TONIN, O Ninja da Roça | 686 |
#1191 | Dublacadabra | 684 |
#1192 | Kauan do TF | 683 |
#1193 | TioHanzo | 681 |
#1194 | C) simon | 681 |
#1195 | ᵃˡᵉˣ | 681 |
#1196 | 1nK | 680 |
#1197 | Faustão Sombrio | 680 |
#1198 | chulo | 679 |
#1199 | Gato | 679 |
#1200 | F3rKillerG4inst | 679 |
#1201 | Que (F2p) | 678 |
#1202 | RetlawDB | 677 |
#1203 | Punchman227 | 676 |
#1204 | Sona | 676 |
#1205 | LLL pANcada | 675 |
#1206 | bruno | 675 |
#1207 | mijail1024 | 674 |
#1208 | eh o chris | 673 |
#1209 | I shoot you! BANG! | 673 |
#1210 | kagaston1 | 670 |
#1211 | ian? | 669 |
#1212 | slothmaster737 | 669 |
#1213 | Ametist | 668 |
#1214 | rojas | 666 |
#1215 | Hat | 666 |
#1216 | rayanaltinoalves12 | 664 |
#1217 | Moataz.MT | 663 |
#1218 | 321oob2 | 661 |
#1219 | weather carl | 661 |
#1220 | EretoGuy | 660 |
#1221 | L0rd_Tubsz | 658 |
#1222 | Stonepanda | 657 |
#1223 | gelincik avcısı | 657 |
#1224 | Urielcaradepapa | 657 |
#1225 | deinosuchos | 656 |
#1226 | Boar | 655 |
#1227 | The Man Who Sold The World | 653 |
#1228 | Sr_gongonza | 653 |
#1229 | How big is the moon? | 653 |
#1230 | Sharen | 652 |
#1231 | Stritious | 652 |
#1232 | sim sou o lelo | 650 |
#1233 | Goiaba | 649 |
#1234 | TheLastWho | 649 |
#1235 | rukksuw | 645 |
#1236 | gooby snoobert | 645 |
#1237 | Hexacreator | 645 |
#1238 | bear with a sandvich | 644 |
#1239 | Kuba | 643 |
#1240 | Evolve | 643 |
#1241 | RodroCoco | 641 |
#1242 | LIGHT | 641 |
#1243 | Rosa Sakamaki | 641 |
#1244 | Sylvia | 640 |
#1245 | obijames | 639 |
#1246 | ghx.tc {brasil} | 638 |
#1247 | SwizzY | 636 |
#1248 | Gume | 636 |
#1249 | Not Your Average Brazilian | 636 |
#1250 | frankinho | 635 |
#1251 | AY| misha | 635 |
#1252 | (AI) | 635 |
#1253 | eduardoespada123 | 635 |
#1254 | Kaetzar | 634 |
#1255 | gator | 629 |
#1256 | vinicius_54 | 628 |
#1257 | Dr. Eric Buensuceso | 628 |
#1258 | Ikun | 628 |
#1259 | :o | 627 |
#1260 | la gorda de la scout | 626 |
#1261 | hacdaq | 625 |
#1262 | Saoxaaen | 625 |
#1263 | noot | 624 |
#1264 | Srkojee | 622 |
#1265 | Isaiah 7:14 | 622 |
#1266 | PALHAAAᴶᵃ̈ᵍᵉʳ✟ | 622 |
#1267 | pako | 622 |
#1268 | Movyis | 621 |
#1269 | idkfa | 617 |
#1270 | Shadow | 617 |
#1271 | Theri | 616 |
#1272 | :p | 615 |
#1273 | León Amphi | 615 |
#1274 | Lolasosupremo | 615 |
#1275 | MaRC_2713 | 614 |
#1276 | pneu | 614 |
#1277 | Dragor | 614 |
#1278 | Artifício | 614 |
#1279 | GrandmaAshesSniffer | 614 |
#1280 | Mandy | 612 |
#1281 | Keko_Nerd | 612 |
#1282 | LonkyChonky | 611 |
#1283 | Xyther | 611 |
#1284 | Dr.Bustdown | 610 |
#1285 | sorry for ruin | 609 |
#1286 | KIDTORNADO | 609 |
#1287 | tophat | 608 |
#1288 | Sleepy | 608 |
#1289 | Ham #FixTF2 | 608 |
#1290 | Rigotoni | 607 |
#1291 | besnick | 606 |
#1292 | joaosilvanum3 | 606 |
#1293 | omegoide | 605 |
#1294 | BooZ | 605 |
#1295 | Jester | 602 |
#1296 | B0LTz | 602 |
#1297 | WhiteD3ath | 597 |
#1298 | SnailDude | 597 |
#1299 | λlsitri2404 | 597 |
#1300 | Graham2012 | 597 |
#1301 | besta enjaulada | 597 |
#1302 | ♰spiritual healing♰ | 596 |
#1303 | Cattir | 593 |
#1304 | TheGreatLogan | 592 |
#1305 | twitch.tv/thesuroh | 591 |
#1306 | tiky | 591 |
#1307 | Porker | 590 |
#1308 | i might play some xbox today | 589 |
#1309 | Mike | 589 |
#1310 | SleepyCrow | 588 |
#1311 | You The Spooker | 587 |
#1312 | feldspar | 586 |
#1313 | Nictrol | 584 |
#1314 | Revolver Ocelot | 583 |
#1315 | Unrustled | 583 |
#1316 | Mystic Meg | 582 |
#1317 | dj poop thrower | 581 |
#1318 | therustyshackles | 581 |
#1319 | ian.navarrorebolledo.01 | 581 |
#1320 | Firestorm_defender | 580 |
#1321 | Saul Goodman | 579 |
#1322 | DrPIG_MENN | 579 |
#1323 | Paulin Bacana | 579 |
#1324 | Harbd | 578 |
#1325 | كلب غواتون | 578 |
#1326 | medic tf2 | 578 |
#1327 | Zircon | 577 |
#1328 | Q.Nelly | 576 |
#1329 | Mald0r | 575 |
#1330 | zick | 575 |
#1331 | [YOG] [Manno] Holandês Voador | 575 |
#1332 | daeb | 574 |
#1333 | Fakku Moment | 574 |
#1334 | asjcl899 | 573 |
#1335 | poubel.marcelo | 573 |
#1336 | zé bom de perna | 572 |
#1337 | JBallsCSU | 571 |
#1338 | SP4RKL3 G4M3R | 570 |
#1339 | Ledmot | 570 |
#1340 | drain fafnir | 569 |
#1341 | deldebu | 569 |
#1342 | nepnep | 568 |
#1343 | Spoot | 567 |
#1344 | jogoeslegau | 567 |
#1345 | BottlePort | 567 |
#1346 | xXx_Am0stradinh0'd4's1lv4_xXx | 567 |
#1347 | avo | 566 |
#1348 | Scout Gaming | 566 |
#1349 | pedrouska | 566 |
#1350 | Ton Drakonta | 566 |
#1351 | Rosenkreuz | 565 |
#1352 | HEEEEELP | Helldiver | 564 |
#1353 | honey pie | 564 |
#1354 | Tyler the creator fan | 563 |
#1355 | lukekul3279 | 563 |
#1356 | LINS |FMS| | 563 |
#1357 | Pedro050 | 562 |
#1358 | DisfrutadorDeAsado[Arg | 562 |
#1359 | Railspark | 561 |
#1360 | Dahunta70 | 559 |
#1361 | Rumblepak | 557 |
#1362 | marcelo | 556 |
#1363 | raphael | 554 |
#1364 | oreoavocado101 | 553 |
#1365 | L o h a n | 552 |
#1366 | Potato Jeremy | 551 |
#1367 | perniciousOverkill | 551 |
#1368 | ConraP | 551 |
#1369 | Gabs | 551 |
#1370 | goldapples | 550 |
#1371 | beans | 550 |
#1372 | Soul | 550 |
#1373 | AverageGamesFan | 549 |
#1374 | alatara592312 | 549 |
#1375 | Captain_Howzer | 548 |
#1376 | Pirula69 | 548 |
#1377 | Fusion 神聖な | 547 |
#1378 | MegoelMago | 547 |
#1379 | Rainerx | 547 |
#1380 | John | 547 |
#1381 | Homlesness | 546 |
#1382 | Jeremy | 545 |
#1383 | forgotten_ | 543 |
#1384 | matgoat | 543 |
#1385 | diegorisas | 543 |
#1386 | coolergate | 542 |
#1387 | www.youtube.com/prisoner | 542 |
#1388 | luan | 542 |
#1389 | djordan183 | 541 |
#1390 | Максон пулик) | 540 |
#1391 | abdkark | 538 |
#1392 | The Bean Probe | 538 |
#1393 | CervejaAntarcticaOFC | 538 |
#1394 | confirmadamente 150 de qi | 537 |
#1395 | ✩Jenizin✩ | 537 |
#1396 | scout main | 536 |
#1397 | Zenca | 536 |
#1398 | Dee | 535 |
#1399 | tec9 | 534 |
#1400 | Sandra Himr | 534 |
#1401 | Eis que leto | 533 |
#1402 | Passport Stealer | 533 |
#1403 | International | 532 |
#1404 | Scrubman | 532 |
#1405 | Kqman | 532 |
#1406 | elviaciadomati456 | 531 |
#1407 | Doc Bird | 530 |
#1408 | I Got No Chaddi | 530 |
#1409 | pancho | 529 |
#1410 | Amaya | 528 |
#1411 | tornado11332 | 528 |
#1412 | LuanMPS2009 | 527 |
#1413 | WE ARE ONE | 526 |
#1414 | Literal Otter | 525 |
#1415 | informe sseu sekso | 524 |
#1416 | Niggamen22 | 523 |
#1417 | Yuzu | 523 |
#1418 | GuacamoleChipz | 523 |
#1419 | Femboy Bakugou | 522 |
#1420 | TURDUCK_3N | 521 |
#1421 | WEVERTON#0522 | 521 |
#1422 | Tararira | 521 |
#1423 | NicoZoffy | 520 |
#1424 | Белая голова | 519 |
#1425 | annie | 519 |
#1426 | Fishark_lol | 519 |
#1427 | Bastien.AG | 518 |
#1428 | Kris General do Cu/Pedro of War | 518 |
#1429 | Delo Sama | 518 |
#1430 | 55Monzter | 518 |
#1431 | Lemon | 518 |
#1432 | Giga Chad Gaming | 517 |
#1433 | elmercenario19 | 517 |
#1434 | davi chablau | 515 |
#1435 | emstaduda | 515 |
#1436 | SDiaz | 515 |
#1437 | Sting | 515 |
#1438 | steeze master | 513 |
#1439 | Rox_167 | 513 |
#1440 | Cosmic Cowgirl | 511 |
#1441 | Neehonga | 510 |
#1442 | Biscoitotriste | 510 |
#1443 | H5N1 Pandemic for 2025 | 509 |
#1444 | Joa Sosa | 509 |
#1445 | LuigiDany | 508 |
#1446 | Distop | 508 |
#1447 | reactor operator | 508 |
#1448 | FRANKITO | 506 |
#1449 | DAZ1A | 505 |
#1450 | gorro gaming | 505 |
#1451 | Saint D. Adre | 503 |
#1452 | ุDango Balango | 503 |
#1453 | demokight | 503 |
#1454 | o_vizinho | 502 |
#1455 | twopaypal | 502 |
#1456 | Smile | 501 |
#1457 | ViPPeR_666 | 501 |
#1458 | Alex | 498 |
#1459 | Jijiano | 498 |
#1460 | ZombieGato | 498 |
#1461 | CDubs | 497 |
#1462 | brr brr patapim | 497 |
#1463 | Phobos VHS | 497 |
#1464 | Max | 496 |
#1465 | GoyoPolloyo | 496 |
#1466 | iGaB | 496 |
#1467 | Stone_Mind | 496 |
#1468 | Miken | 496 |
#1469 | outro lugar | 495 |
#1470 | beanie®™© | 495 |
#1471 | octarr | 495 |
#1472 | elon moxxx | 495 |
#1473 | !!DEAD GODS!! | 494 |
#1474 | haluve | 493 |
#1475 | el_cachupas_ | 493 |
#1476 | Osaka | 492 |
#1477 | jacksonjose0148 | 492 |
#1478 | Novacain | 492 |
#1479 | alec | 491 |
#1480 | Thicc Booty Foxy | 491 |
#1481 | Bananaphone | 489 |
#1482 | Entrenós | 489 |
#1483 | Star (The Femboy) | 488 |
#1484 | pd | 488 |
#1485 | zRec4ldo | 488 |
#1486 | Ostebrød | 487 |
#1487 | Za. | 487 |
#1488 | ITS MAGIC | 486 |
#1489 | x3 :3 >.< ;) ;3 >:p >:3 <3 T^T | 485 |
#1490 | noeale0843 | 484 |
#1491 | 58 (she/her) | 484 |
#1492 | iloveyou | 484 |
#1493 | ilovepepsi | 483 |
#1494 | Adi_Kmd | 482 |
#1495 | larry | 480 |
#1496 | ђAкAяi | 480 |
#1497 | YASJ9000 | 479 |
#1498 | [VET]Meta | 478 |
#1499 | hubi | 478 |
#1500 | Aigis suplex | 477 |
#1501 | eyes on the prize | 475 |
#1502 | LuMaX211 | 475 |
#1503 | Roniesker0 | 473 |
#1504 | BRYAN | 472 |
#1505 | aLittleBigMan | 471 |
#1506 | so pego menor de 16 | 471 |
#1507 | asal nex | 470 |
#1508 | zbrainz | 470 |
#1509 | cArlito | 469 |
#1510 | allanzinho | 469 |
#1511 | mats | 469 |
#1512 | Sójrates1 | 468 |
#1513 | Banana Mann (also Saxton Hale) | 468 |
#1514 | tuttifrutti | 468 |
#1515 | boy | 466 |
#1516 | shea, the bae. | 466 |
#1517 | V for Valentine | 465 |
#1518 | Finn | 465 |
#1519 | bootstrap | 463 |
#1520 | Homelessman61 | 462 |
#1521 | Insert_Name_Here | 462 |
#1522 | babilon | 461 |
#1523 | LopO* El mimo | 460 |
#1524 | Gaggins | 460 |
#1525 | Local Idiot | 458 |
#1526 | sagij | 457 |
#1527 | gefersonsamuelgamer2012 | 456 |
#1528 | Troidyy | 456 |
#1529 | nagel | 456 |
#1530 | ww | 455 |
#1531 | BOOM | 455 |
#1532 | murimarch | 455 |
#1533 | LEITADA | 454 |
#1534 | Jorel | 454 |
#1535 | Thimodeu | 454 |
#1536 | Dallas | 454 |
#1537 | McLovin | 452 |
#1538 | Smartitatat | 452 |
#1539 | AY|Master_Bruh | 452 |
#1540 | Edgeworth | 451 |
#1541 | CaptainSushi | 451 |
#1542 | Concept | 451 |
#1543 | Pedrinho da Balsa | 451 |
#1544 | ketchopz | 451 |
#1545 | TheHandyFamily | 450 |
#1546 | pos5 | 450 |
#1547 | mrguydudemanperson | 450 |
#1548 | The_BurritoMan | 449 |
#1549 | ifyklikeiktheneverythingshouldb | 449 |
#1550 | zazilia_ | 449 |
#1551 | T-Bone61 | 449 |
#1552 | Chanerian | 449 |
#1553 | i can talk :) | 449 |
#1554 | Professional Spy Main | 449 |
#1555 | Cookie | 448 |
#1556 | Duckman | 448 |
#1557 | Райан Гослинг | 448 |
#1558 | ih8veiie | 447 |
#1559 | .Young Beef AKA LANA DEL REY | 447 |
#1560 | Anal Inspector | 446 |
#1561 | STEAK,FISH & CLASSIC | 446 |
#1562 | Myata | 444 |
#1563 | FUCKINCAT | 444 |
#1564 | leandro | 443 |
#1565 | - Pepe.ドリーマ | 443 |
#1566 | pinatti055 | 443 |
#1567 | [TAAG]Disrupter64 | 442 |
#1568 | Jabs | 440 |
#1569 | Chinocrix | 440 |
#1570 | sada | 440 |
#1571 | Mr.Sleepy4935 | 439 |
#1572 | kowloon | 439 |
#1573 | GabrielNotSoOnline | 439 |
#1574 | XxX_ElProGamer_XxX | 438 |
#1575 | Digital | 438 |
#1576 | gdtorresr | 438 |
#1577 | Сын фимоза | 438 |
#1578 | Cloudster | 438 |
#1579 | ungy boba | 438 |
#1580 | MAGO | 437 |
#1581 | Damsel of Darkness | 437 |
#1582 | Jbro | 436 |
#1583 | GearsOfZAKYIA | 436 |
#1584 | pao363 | 435 |
#1585 | lil guy | 435 |
#1586 | emapolaro | 435 |
#1587 | tswolverine1 | 434 |
#1588 | ManelDoCeará | 434 |
#1589 | raciocinio racional | 433 |
#1590 | Mr silly | 433 |
#1591 | The Dice | 433 |
#1592 | satanized | 432 |
#1593 | warrior | 432 |
#1594 | cateredition | 429 |
#1595 | GAMERNAREE | 429 |
#1596 | CyrusBirb | 429 |
#1597 | Seboso Gameplays | 428 |
#1598 | sky | 428 |
#1599 | Dud_cyw | 428 |
#1600 | juju | 428 |
#1601 | Churumela | 427 |
#1602 | -mãozinha | 427 |
#1603 | vosko | 427 |
#1604 | obboL | 426 |
#1605 | Romeo | 425 |
#1606 | DarlanDK #Fixtf2 | 425 |
#1607 | Morgot the hawk | 425 |
#1608 | bananª | 424 |
#1609 | Yanuk | 424 |
#1610 | artesian11111 | 423 |
#1611 | Aytrebys | 422 |
#1612 | Moneybrains | 422 |
#1613 | YureiTheGhost | 421 |
#1614 | G-Force FGT | 421 |
#1615 | cubsluv2 | 421 |
#1616 | Luki 1331 | 420 |
#1617 | Perezapien | 420 |
#1618 | MasKrrano_PeaK | 419 |
#1619 | lanie03 | 419 |
#1620 | Miro | 418 |
#1621 | rodolfobracamonte | 417 |
#1622 | Katineo | 417 |
#1623 | Cooked Meat | 416 |
#1624 | tererestyle | 416 |
#1625 | Tô sem troco, toma essa bala. | 415 |
#1626 | Darkus59 | 415 |
#1627 | Temp☺rarily | 415 |
#1628 | P | 414 |
#1629 | henriqueycaro88 | 414 |
#1630 | LucasLixoso | 413 |
#1631 | Commander Luck | 413 |
#1632 | BillzyGang | 413 |
#1633 | Juninho | 412 |
#1634 | Octopus | 411 |
#1635 | S7dney | 410 |
#1636 | Doutor mario | 409 |
#1637 | ГИПЕР GOOSE | 408 |
#1638 | roy1530 | 408 |
#1639 | Hincha | 408 |
#1640 | TEITOTOSO | 407 |
#1641 | NanoFalls | 406 |
#1642 | Nihillquiunum | 406 |
#1643 | RUKAS4NTS | 406 |
#1644 | Päk | 406 |
#1645 | allenawesomeadventures | 405 |
#1646 | Chris Thievul | 405 |
#1647 | PortalFreak | 405 |
#1648 | JankedKn | 405 |
#1649 | ʟᴀᴘᴘʏ | 404 |
#1650 | v4nboura | 403 |
#1651 | Javierstyllez | 402 |
#1652 | MISSING_TEXTURE.EXE | 401 |
#1653 | Veio | 400 |
#1654 | schumbs | 400 |
#1655 | Dan Smith | 399 |
#1656 | Swellest | 399 |
#1657 | Leche mala | 399 |
#1658 | Maverick | 398 |
#1659 | PYR0SHARK | 398 |
#1660 | japonesfg | 397 |
#1661 | twink cat | 396 |
#1662 | spoonful of protons | 396 |
#1663 | terminal connection | 395 |
#1664 | Andrômeda | 395 |
#1665 | FamedBasket | 394 |
#1666 | gauchopetero | 394 |
#1667 | cones12 | 394 |
#1668 | notnotayt13 | 393 |
#1669 | Sandoitchi | 393 |
#1670 | I Be Thuggin It Rn | 393 |
#1671 | P4T0 | 392 |
#1672 | JGUY #FixTF2 | 392 |
#1673 | Catfeine | 392 |
#1674 | I am sean mcclary | 392 |
#1675 | Curtburt_Gaming | 392 |
#1676 | COFFEE!!! | 391 |
#1677 | Bob | 391 |
#1678 | Insecure Potato | 391 |
#1679 | Kingdelta | 391 |
#1680 | Vob | 390 |
#1681 | AJ | 390 |
#1682 | HelloAPerson | 390 |
#1683 | i love goth girls | 389 |
#1684 | beckstupfel | 389 |
#1685 | magugazinho | 389 |
#1686 | Kill-Nova | 389 |
#1687 | Otter359 | 389 |
#1688 | Claudette | 389 |
#1689 | GTAvROSS | 388 |
#1690 | Bungo | 388 |
#1691 | flippy | 387 |
#1692 | What the dog doin | 387 |
#1693 | Fefe | 387 |
#1694 | Robin!! | 387 |
#1695 | t* | 386 |
#1696 | Tecrif | 386 |
#1697 | Metira | 385 |
#1698 | ShorttEclipse | 385 |
#1699 | Xx_m1lkz1m_xX | 384 |
#1700 | JXN_DEATHDEALER | 384 |
#1701 | buster scruggs | 384 |
#1702 | Caramujo Sonolento | 384 |
#1703 | 『ꜱᴀᴠᴀɴᴛ』 | 384 |
#1704 | Infinity | 384 |
#1705 | Honk! | 384 |
#1706 | sebastianvilchesjorquera | 383 |
#1707 | Sev | 383 |
#1708 | octavia117 | 383 |
#1709 | Snakebreak | 382 |
#1710 | chaotic_llama09 | 382 |
#1711 | Chilly | 382 |
#1712 | MF BOOM | 381 |
#1713 | joaogabriel.cmendes2013 | 381 |
#1714 | fantasma | 380 |
#1715 | The Green Goblin | 378 |
#1716 | الهامستر اللاعب | 375 |
#1717 | Master_T | 375 |
#1718 | Sado | 375 |
#1719 | mattano | 374 |
#1720 | sleepingsoldier | 374 |
#1721 | Joshg43 | 374 |
#1722 | ドリーム | 373 |
#1723 | ᗜ˰ᗜ | 373 |
#1724 | Mikhail | 372 |
#1725 | Cash The Egg | 372 |
#1726 | kickshot8010 | 372 |
#1727 | LEOperator | 372 |
#1728 | WALL-E | 371 |
#1729 | oats | 371 |
#1730 | V4Vincent | 371 |
#1731 | moxie | 370 |
#1732 | Con-fetti | 369 |
#1733 | Gameboomer15 | 369 |
#1734 | joseflukyan2014 | 369 |
#1735 | EDead904 | 368 |
#1736 | Hue CSZ | 367 |
#1737 | skaterrrrr | 367 |
#1738 | o psicologico comanda o corpo | 367 |
#1739 | ARTHUR | 367 |
#1740 | spoovy | 366 |
#1741 | Chapï ⸸ | 366 |
#1742 | domain_expansion | 366 |
#1743 | wankinha | 365 |
#1744 | Kennedy | 365 |
#1745 | andrew | 365 |
#1746 | Dr.Gibus | 364 |
#1747 | banana juul | 364 |
#1748 | AyinBatata | 364 |
#1749 | Cluster | 363 |
#1750 | medic | 363 |
#1751 | Pizza Mozzarella | 363 |
#1752 | stinkBot | 362 |
#1753 | R3gdar | 362 |
#1754 | Toyota Hilux | 361 |
#1755 | chino777 | 360 |
#1756 | Carlinhos | 360 |
#1757 | Komeiji Luis | 359 |
#1758 | Kael | 359 |
#1759 | netomunizpereira | 359 |
#1760 | Zélinguine2.0 | 358 |
#1761 | cinnamonkey | 358 |
#1762 | Maxikarp | 358 |
#1763 | A | 358 |
#1764 | Thomaz01 | 358 |
#1765 | vuprkr | 358 |
#1766 | Ducki_noob :D | 357 |
#1767 | NotTheFox | 356 |
#1768 | WitchKitty | 356 |
#1769 | Def | 356 |
#1770 | naim | 355 |
#1771 | Peixe Gay Boi | 354 |
#1772 | k3stayl0r | 353 |
#1773 | GalaxyBoss7 | 353 |
#1774 | Capivara Cibernetica | 353 |
#1775 | Something Silly | 351 |
#1776 | unaidedbull3867 | 351 |
#1777 | lickity lee | 351 |
#1778 | Lasvoss | 351 |
#1779 | Bonde do kareka | 351 |
#1780 | Iswaag Newton 100tifiko | 351 |
#1781 | Lorenzão do grau | 350 |
#1782 | beltransalgado12 | 350 |
#1783 | Cobby Halloween | 349 |
#1784 | N-ão | 349 |
#1785 | ZMateus25_ET | 349 |
#1786 | Squee | 349 |
#1787 | Spycy_Mann | 348 |
#1788 | I'm Invisible | 348 |
#1789 | zephiron | 348 |
#1790 | Gordo Bondiola | 346 |
#1791 | Gotashi | 346 |
#1792 | RoundCat | 345 |
#1793 | unk | 345 |
#1794 | toadsc | 343 |
#1795 | Piss-Chan | 343 |
#1796 | Spooky Scary'Steka | 343 |
#1797 | clobbyn | 343 |
#1798 | Male07 | 342 |
#1799 | LegacyBee | 341 |
#1800 | Risoto | 341 |
#1801 | isac™ | 341 |
#1802 | GENNN0ZSPY | 341 |
#1803 | Free Kelly | 341 |
#1804 | hillbillyj0el | 341 |
#1805 | fugwicha | 340 |
#1806 | Kooltres | 340 |
#1807 | Zezin docaixo | 340 |
#1808 | банк ослиной моч | 340 |
#1809 | Martino | 340 |
#1810 | Frankito P. c: | 339 |
#1811 | El Caca | 339 |
#1812 | Kargo | 339 |
#1813 | GIGANTE | 339 |
#1814 | CONTROLLER_PLAYER(no kidding) | 339 |
#1815 | dk | 339 |
#1816 | Rato Do Sing Falando Caraio | 338 |
#1817 | oliviapuppy.frolic2006 | 335 |
#1818 | Oren | 335 |
#1819 | dawiamigo | 335 |
#1820 | kanjiso | 335 |
#1821 | 12goshi | 335 |
#1822 | Marja0005 | 335 |
#1823 | Metaladon | 334 |
#1824 | swag missayah | 334 |
#1825 | F6RRY_KILLER | 333 |
#1826 | loshun | 332 |
#1827 | MOGUL PRIME | 332 |
#1828 | Thinking. | 332 |
#1829 | poporilo | 332 |
#1830 | MAYO <3 | 332 |
#1831 | diyazagh26 | 332 |
#1832 | JpApx | 332 |
#1833 | lspd | 332 |
#1834 | Z1X | 331 |
#1835 | estocio chillskis | 330 |
#1836 | kromor | 329 |
#1837 | ser humano | 329 |
#1838 | horse | 329 |
#1839 | Kage #banditcamp | 329 |
#1840 | Alex | 329 |
#1841 | CABER.CRUSADER | 328 |
#1842 | idkreal | 327 |
#1843 | DISCONSOLA | 326 |
#1844 | CHOPPER "El Matazanoz" | 326 |
#1845 | ElEspantaHumanos | 326 |
#1846 | Pasto | 326 |
#1847 | Predador | 325 |
#1848 | Zuyo | 324 |
#1849 | QosmicQwilfer | 324 |
#1850 | Ashura | 324 |
#1851 | Soren | 324 |
#1852 | MANU DIBANGO | 324 |
#1853 | f2 | 323 |
#1854 | GP | 323 |
#1855 | Edward | 323 |
#1856 | Cloaking | 323 |
#1857 | ShadowLefty__/TTV | 323 |
#1858 | cumington_wabledick1782 | 322 |
#1859 | BizarroSamuel | 322 |
#1860 | DylanDav | 321 |
#1861 | greenan | 321 |
#1862 | xGh0st1x_ | 321 |
#1863 | ChapaDown | 321 |
#1864 | LordDoSUS | 320 |
#1865 | Ludizin | 319 |
#1866 | feet connoisseur | 318 |
#1867 | joe pastrami | 318 |
#1868 | Oddly Flammable | 317 |
#1869 | bird | 317 |
#1870 | TanqueAlbino | 317 |
#1871 | N | 317 |
#1872 | Nicoly12 | 317 |
#1873 | Bingus | 316 |
#1874 | hellsing | 316 |
#1875 | ツDASOF | 315 |
#1876 | hrgratz | 315 |
#1877 | Professional Clown | 313 |
#1878 | ☯fabinho☯™ | 313 |
#1879 | The Golfiest | 312 |
#1880 | freaky_pyro | 312 |
#1881 | DoctorStupid | 311 |
#1882 | moodwoboo :3 | 310 |
#1883 | why so serious | 310 |
#1884 | Lumea | 310 |
#1885 | 「Grλves」 | 309 |
#1886 | MAX/ART | 308 |
#1887 | POLÍCIA FEDERAL | 308 |
#1888 | magazine luiza pelada | 307 |
#1889 | H.A.S.U. | 306 |
#1890 | Primata | 306 |
#1891 | Partner | 306 |
#1892 | Shoebill | 306 |
#1893 | Big Boss | 306 |
#1894 | rubin1out | 305 |
#1895 | Ryisuh | 305 |
#1896 | InsertKurt | 305 |
#1897 | atiuqse_m | 305 |
#1898 | .Conlaed | 304 |
#1899 | lovefoxxx | 304 |
#1900 | Milky | 304 |
#1901 | lil lad | 304 |
#1902 | Hatless | 304 |
#1903 | Invisible Teammate | 303 |
#1904 | man of remarkably low intellect | 303 |
#1905 | lubileski | 303 |
#1906 | Captain Muskie | 303 |
#1907 | Fimmel | 303 |
#1908 | JEFE DEL DINERO | 302 |
#1909 | | | Aaron | | | 302 |
#1910 | ARIZONA | 302 |
#1911 | Mario Pueyrredon | 302 |
#1912 | Eyeguy!1 (SPOOPY) | 302 |
#1913 | ARGFranco | 302 |
#1914 | stupid shy dog | 301 |
#1915 | VV gekoh. | 301 |
#1916 | kay | 301 |
#1917 | Gomarra | 301 |
#1918 | Leomancer | 301 |
#1919 | Discredited Cook | 301 |
#1920 | Fart the Clown | 300 |
#1921 | Tombstone Road | 300 |
#1922 | Eles tão bizoiando nois da Sil | 300 |
#1923 | cokinho] | 300 |
#1924 | Jpb0864882 | 300 |
#1925 | H.P | 300 |
#1926 | The Redeemer | 299 |
#1927 | ็ | 299 |
#1928 | TonyTheNoob | 299 |
#1929 | Panchizo | 299 |
#1930 | JONATHNA18 | 298 |
#1931 | Infinitive | 298 |
#1932 | roggia | 297 |
#1933 | Zoldyck | 297 |
#1934 | derre3 | 297 |
#1935 | k6 dynamite (medic) | 297 |
#1936 | Uroboroth Mann | 297 |
#1937 | Blobs | 296 |
#1938 | beans | 296 |
#1939 | Mido | 295 |
#1940 | Maxcupcake | 295 |
#1941 | Evellyn | 295 |
#1942 | Especialito410 | 295 |
#1943 | Bloodoverflow | 295 |
#1944 | apz | 294 |
#1945 | shimuun | 294 |
#1946 | dr. ultra slut body detergent | 294 |
#1947 | dama dama | 294 |
#1948 | s2.0.32 | 293 |
#1949 | eduardocarrera708 | 293 |
#1950 | Frank KGBobo | 293 |
#1951 | Ad-09Play | 293 |
#1952 | Arıusıto | 293 |
#1953 | SlackerTown | 292 |
#1954 | リムル=テンペスト | 292 |
#1955 | greysriver | 292 |
#1956 | big raul | 291 |
#1957 | Koi | 291 |
#1958 | edjubeans | 291 |
#1959 | CrowBart | 291 |
#1960 | kretzingerjayme | 291 |
#1961 | callumwallum98 | 291 |
#1962 | Nutzeeb | 291 |
#1963 | the WORST at gaming | 291 |
#1964 | Nosíno | 290 |
#1965 | Clone | 289 |
#1966 | PRIMO OSVAL2 | 289 |
#1967 | PH | 289 |
#1968 | Key | 288 |
#1969 | guilhermegmartins7 | 288 |
#1970 | mrscaryjrjr | 288 |
#1971 | FakeCornStarch | 288 |
#1972 | Brzero | 287 |
#1973 | 1 sitting bull fan | 286 |
#1974 | Gaben | 286 |
#1975 | Puhckaaaa | 285 |
#1976 | wood | 285 |
#1977 | Sr.Dhoss | 285 |
#1978 | Ⓚⓔⓡⓑⓔⓡⓞⓢ | 285 |
#1979 | Ass Blaster, Disaster Master | 284 |
#1980 | vlaker | 284 |
#1981 | LiterallyMe | 283 |
#1982 | Сатору Гойда | 283 |
#1983 | Dominus Imperius | 283 |
#1984 | leonardosilvatoro | 283 |
#1985 | TwinDash2 | 283 |
#1986 | CARTOON GAMING | 283 |
#1987 | Banuno | 283 |
#1988 | jklgamer | 282 |
#1989 | moongazer07 | 282 |
#1990 | gallohijolg | 282 |
#1991 | Codebreaker | 282 |
#1992 | RakyPlayTF | 281 |
#1993 | Misericordia96 | 281 |
#1994 | Yuri | 281 |
#1995 | potato15 | 280 |
#1996 | rojasbenjamindaniel27 | 280 |
#1997 | YOUR GAY 504 | 280 |
#1998 | tukinhao | 279 |
#1999 | the elevator demo | 278 |
#2000 | AJ | 278 |
#2001 | Lord_Magoots | 278 |
#2002 | Octodel | 278 |
#2003 | yung fly on the track | 277 |
#2004 | banshee | 277 |
#2005 | Sanguchito | 277 |
#2006 | xnd | 277 |
#2007 | ANTI_PLUSHIE | 277 |
#2008 | SPYWARE GAMER | 276 |
#2009 | demberg69 | 276 |
#2010 | elNegroVilla | 276 |
#2011 | stinky freak | 276 |
#2012 | Anonymo | 275 |
#2013 | Hecker Caracal | 275 |
#2014 | Jester_Ivy | 275 |
#2015 | naive | 275 |
#2016 | CabMjb | 274 |
#2017 | BalderichTwo | 274 |
#2018 | arthur2009 | 274 |
#2019 | Megoko | 273 |
#2020 | aftortaste | 273 |
#2021 | sr angelo | 273 |
#2022 | BestWorstPlayer8310 | 273 |
#2023 | Bicicleta voadora | 272 |
#2024 | swagmaster | 272 |
#2025 | levi.mcintee | 272 |
#2026 | Siege Engine | 272 |
#2027 | unit 3650 (ez2) | 272 |
#2028 | abravanelix | 271 |
#2029 | heakvshek | 270 |
#2030 | mosguito penislongo | 270 |
#2031 | Calvo_Gaming | 270 |
#2032 | m∂xw∈ll | 269 |
#2033 | 76561199387861058 | 269 |
#2034 | Internal | 269 |
#2035 | silvsplifer | 269 |
#2036 | Dino_games69 | 268 |
#2037 | brew | 268 |
#2038 | WyeR | 268 |
#2039 | A Random Day | 268 |
#2040 | Sniperkail | 268 |
#2041 | Two-Teste Tommy | 268 |
#2042 | JuiceboxHero | 268 |
#2043 | Grub | 267 |
#2044 | agustinkeiro13 | 267 |
#2045 | daka | 267 |
#2046 | TheNoob | 267 |
#2047 | Technnare | 267 |
#2048 | Waldo | 266 |
#2049 | Vina | 266 |
#2050 | davigd98 | 266 |
#2051 | empanadaඞ | 266 |
#2052 | watanabeclaudiocesar | 266 |
#2053 | meowchie | 265 |
#2054 | Noit. | 265 |
#2055 | Akira Kogami (Real) | 265 |
#2056 | MattLana | 265 |
#2057 | Tongaas | 265 |
#2058 | SandmanRanger | 265 |
#2059 | Whyy_not | 265 |
#2060 | Big Aronas | 265 |
#2061 | Embananado | 265 |
#2062 | zanderfish | 264 |
#2063 | .•Keka•. | 264 |
#2064 | Aqua | 264 |
#2065 | waluigithemedicsimp | 264 |
#2066 | MicPaper | 264 |
#2067 | Joseph Joestar | 264 |
#2068 | mash | 263 |
#2069 | Chrry | 263 |
#2070 | Kiwi | 263 |
#2071 | mr navysealer | 263 |
#2072 | kanarya 3457 | 263 |
#2073 | DrakaiBr | 263 |
#2074 | Any One of Us | 263 |
#2075 | Katnasarwa | 263 |
#2076 | delay | 263 |
#2077 | Desent | 262 |
#2078 | 1216 | 262 |
#2079 | ShadowKaze | 262 |
#2080 | eddyhdzchap | 262 |
#2081 | igr.sst | 262 |
#2082 | sneezewax | 261 |
#2083 | noodle | 261 |
#2084 | JaviDual | 260 |
#2085 | Bonk Atomic Punch | 260 |
#2086 | jaequan mvm | 259 |
#2087 | KisaraL | 259 |
#2088 | mate | 259 |
#2089 | zomber_cuchao | 259 |
#2090 | GROX Gaming | 259 |
#2091 | _GNZ_ | 258 |
#2092 | SIFU on the Linux | 258 |
#2093 | joacoseo | 258 |
#2094 | DragoKirbo | 258 |
#2095 | Lillian ✧ | 258 |
#2096 | Hiro 宏 | 258 |
#2097 | DARK | 258 |
#2098 | Amigo de gimenes | 258 |
#2099 | i cant aim lol | 257 |
#2100 | CvstozZ | 257 |
#2101 | blackliner | 256 |
#2102 | bells | 256 |
#2103 | Pyrose | 255 |
#2104 | themeanseenleangreenbeanmachine | 255 |
#2105 | Tomioka | 255 |
#2106 | lll | 255 |
#2107 | motyskie | 255 |
#2108 | deedee8113 | 255 |
#2109 | Mysterious_Warlock | 255 |
#2110 | monster_xd | 254 |
#2111 | -Yuna- | 254 |
#2112 | Sr_bolas | 254 |
#2113 | TOM BRADY PEEK | 253 |
#2114 | lvcrazybone | 253 |
#2115 | layon | 253 |
#2116 | shotty | 252 |
#2117 | Gustavo MS | 252 |
#2118 | abacaxi | 252 |
#2119 | ÐæmonPlatRøuge | 252 |
#2120 | still | 251 |
#2121 | Euduardo | 251 |
#2122 | BrickGuy32 | 251 |
#2123 | fernan el crack carajo | 251 |
#2124 | Crobarfreeman | 251 |
#2125 | >.< | 251 |
#2126 | RIke | 251 |
#2127 | rai | 251 |
#2128 | Hair Cake | 250 |
#2129 | Cloaker | 250 |
#2130 | bertmaxxing | 250 |
#2131 | guizado | 249 |
#2132 | Ana Maria Braga | 249 |
#2133 | Eog | 249 |
#2134 | NEO// | 248 |
#2135 | soggettivita | 248 |
#2136 | A Simple Pegster | 247 |
#2137 | frozen.neves2406 | 247 |
#2138 | EDU GARALHO | 247 |
#2139 | Não e o Levy | 247 |
#2140 | Goudein Uinde | 247 |
#2141 | Silasv500 | 247 |
#2142 | kluster | 247 |
#2143 | GI Jeff | 246 |
#2144 | Chicken | 246 |
#2145 | dan | 246 |
#2146 | KiwiSi23 (F2P) | 245 |
#2147 | Y | 245 |
#2148 | Spookss | 244 |
#2149 | Strange Festive Marshal | 244 |
#2150 | Pat | 244 |
#2151 | Mr. González | 244 |
#2152 | engineer pumkin | 244 |
#2153 | THOT killer not sorry | 244 |
#2154 | SocknessMonster | 243 |
#2155 | $THE_KEPEER$ | 243 |
#2156 | chetosz | 243 |
#2157 | Flashbang | 243 |
#2158 | Abby | 242 |
#2159 | isaquevictor82 | 241 |
#2160 | solty | 241 |
#2161 | gotinhasouza3 | 241 |
#2162 | Killer-King5324 | 240 |
#2163 | moonman | 240 |
#2164 | Kris | 239 |
#2165 | Grambee | 238 |
#2166 | Skeefo | 238 |
#2167 | zoro | 238 |
#2168 | rodrigochan | 238 |
#2169 | aquafina | 238 |
#2170 | Cebaled | 238 |
#2171 | YxX_GiGaNigGa!!_XxY | 238 |
#2172 | Cosmoose | 237 |
#2173 | @@@@@@@@@@@@@@@@@@@@@@@@@@@@@@@ | 237 |
#2174 | guest | 237 |
#2175 | Pivotto | 237 |
#2176 | deaw | 237 |
#2177 | Cazador de Cabezas | 237 |
#2178 | droga eh o VINNI | 236 |
#2179 | Pikza | 236 |
#2180 | gary | 236 |
#2181 | eloy.gomes | 235 |
#2182 | FrostyFrontier | 235 |
#2183 | CHUPARÃO MIA VARA | 235 |
#2184 | GoodbyerZ | 235 |
#2185 | sCortondo | 234 |
#2186 | Ribs | 234 |
#2187 | mathierry | 234 |
#2188 | lazaro2121 | 234 |
#2189 | Doctor™ | 234 |
#2190 | Alex Die Panzer Lover | 234 |
#2191 | DemiurgoDaSilvazeto | 234 |
#2192 | mimi | 233 |
#2193 | SilvaV46 | 233 |
#2194 | tchovis | 233 |
#2195 | MonoLoco69 | 233 |
#2196 | Paçoca | 233 |
#2197 | irony | 233 |
#2198 | Anti-Citzen 1 | 232 |
#2199 | Cyrllo | 232 |
#2200 | thatguy_186 | 232 |
#2201 | mango elf bar | 232 |
#2202 | BATMAN NINJA | 231 |
#2203 | hunter104 | 231 |
#2204 | Personofearth | 231 |
#2205 | Flematrix | 230 |
#2206 | Chevette Usado | 230 |
#2207 | GHD Furia | 230 |
#2208 | afterlife | 230 |
#2209 | Poly_Pumpkins | 230 |
#2210 | bautistaalochis | 229 |
#2211 | HelpImSeverlyDehydrated | 228 |
#2212 | specter365 | 228 |
#2213 | Quick Fix Medic Bot | 228 |
#2214 | xolf | 227 |
#2215 | Dirty Larry | 227 |
#2216 | kirbo | 227 |
#2217 | -Alamino | 227 |
#2218 | WorldsLargestPlanet | 227 |
#2219 | Maxim^^ | 226 |
#2220 | grilo | 226 |
#2221 | atomix | 226 |
#2222 | FishyFrenzy | 225 |
#2223 | DrSilver | 225 |
#2224 | nicktolas | 225 |
#2225 | Commander Pigeon | 225 |
#2226 | gm_construct | 224 |
#2227 | Pererecão | 224 |
#2228 | taiada | 224 |
#2229 | grozzermozzer | 224 |
#2230 | gt | 223 |
#2231 | Ŧєяяαяι♞ | 223 |
#2232 | Zinid | 223 |
#2233 | raiden mgs2 paulista | 223 |
#2234 | The Reaper | 223 |
#2235 | stay frosty! | 223 |
#2236 | Soda | 223 |
#2237 | (Not) CYN | 222 |
#2238 | Pedro Pedregulho Pedroso™ | 222 |
#2239 | Zogueiro | 222 |
#2240 | Capitão Palmeiras | 222 |
#2241 | faustoglucarini | 222 |
#2242 | MagnusJester | 221 |
#2243 | oleee33 | 221 |
#2244 | MaRc0s | 221 |
#2245 | Astro ._. | 221 |
#2246 | Mate Cogido Con Chele | 220 |
#2247 | Troni | 220 |
#2248 | Stock ☻ | 220 |
#2249 | Bog Monster | 219 |
#2250 | DsM0ta | 219 |
#2251 | May or may not kill friendlies | 219 |
#2252 | bonnie | 218 |
#2253 | vinylucenaamorim12 | 218 |
#2254 | aarapoc25 | 218 |
#2255 | toruguin ツ | 218 |
#2256 | CLAUDIOKILL | 218 |
#2257 | XanaX | 218 |
#2258 | out of love and out of feeling | 218 |
#2259 | hello_comrad | 218 |
#2260 | altaria | 217 |
#2261 | Aimer the Gamer | 217 |
#2262 | Keasna | 217 |
#2263 | ♥️ maxi ♥ | 217 |
#2264 | eltongarra25 | 217 |
#2265 | PixelXd | 217 |
#2266 | hiranokite | 216 |
#2267 | GunnerZero | 216 |
#2268 | luffy | 216 |
#2269 | sandvich gaming the roise updat | 216 |
#2270 | Faniss | 215 |
#2271 | Pankakes | 215 |
#2272 | The Diggler | 215 |
#2273 | PESUTI | 215 |
#2274 | catbot v2 | 214 |
#2275 | i'm a toilet that spins | 214 |
#2276 | Longshlongertin | 214 |
#2277 | M1sterBl4ck | 213 |
#2278 | noskill | 213 |
#2279 | KPera | 213 |
#2280 | Lawn-Chair Critic | 213 |
#2281 | marcelocuevas57 | 213 |
#2282 | professional geeker | 212 |
#2283 | Sir_RedKn1ght | 212 |
#2284 | freakbob | 212 |
#2285 | King Benny | 211 |
#2286 | ♡ Pinky ♡ | 211 |
#2287 | leanfan24 | 211 |
#2288 | Nelvin124 | 211 |
#2289 | doctor sex | 211 |
#2290 | Galoakd | 211 |
#2291 | BasQ | 210 |
#2292 | Foxsome! UwU #FixTF2 | 210 |
#2293 | Rato_Maconha | 210 |
#2294 | ministro edson faquinha | 210 |
#2295 | LOKOO_234 | 209 |
#2296 | radda74 | 209 |
#2297 | xDrk4Sz | 209 |
#2298 | epic | 209 |
#2299 | Penny Trading | 209 |
#2300 | [A-SP] Cobra | 208 |
#2301 | Knufle | 208 |
#2302 | xrl_16 | 208 |
#2303 | Wellthen | 207 |
#2304 | Drew | 207 |
#2305 | lil bro.| HM | 207 |
#2306 | Forte | 207 |
#2307 | 1Bigu | 207 |
#2308 | Koluk | 206 |
#2309 | Rad-ec | trade.tf | 206 |
#2310 | AmirKhaan | 206 |
#2311 | oCabecaDeAguia | 206 |
#2312 | otavio_idle16 | 205 |
#2313 | hectordasilvaalmeida | 205 |
#2314 | supershy | 205 |
#2315 | saco | 205 |
#2316 | lobotomy | 205 |
#2317 | mesi | 205 |
#2318 | Akmacdondon | 204 |
#2319 | Ms. Raposa | 204 |
#2320 | gagemanderville | 204 |
#2321 | Suco | 204 |
#2322 | I | 203 |
#2323 | Kite | 203 |
#2324 | jackingoff | 203 |
#2325 | Rxdline | 203 |
#2326 | Meph | 203 |
#2327 | ꒷꒦˘Favaloro˘꒦꒷ | 203 |
#2328 | LoudFox | 203 |
#2329 | tdillon21 | 203 |
#2330 | biohazardousPrick | 203 |
#2331 | slab_55 | 202 |
#2332 | Max | 202 |
#2333 | Vortex | 202 |
#2334 | -Mask_White- | 202 |
#2335 | mr frog | 202 |
#2336 | abalbuquerque06 | 202 |
#2337 | Neku | 202 |
#2338 | clever john | 201 |
#2339 | Shaigrovil | 201 |
#2340 | d1An€ | 201 |
#2341 | MathyG MODO SERGIO | 200 |
#2342 | finglebober | 200 |
#2343 | boringskedaddle | 200 |
#2344 | Papyrus | 200 |
#2345 | SepiaMoon | 200 |
#2346 | OK | 200 |
#2347 | Perera | 200 |
#2348 | Eclipse | 199 |
#2349 | ingeneergaming 2013 | 199 |
#2350 | wasty23 | 199 |
#2351 | Shaggy | 198 |
#2352 | W†HaZLL !" ß | 198 |
#2353 | FAT DUDE | 198 |
#2354 | sunkistmobile | 198 |
#2355 | lkjsa | 197 |
#2356 | ReacherLou42 | 197 |
#2357 | SD ANDRADE | 197 |
#2358 | < JAMES > | 197 |
#2359 | Scout sospechosamente lento | 197 |
#2360 | bisexual gaming | 197 |
#2361 | TheHipp0z | 196 |
#2362 | bonk | 196 |
#2363 | ricardoparra | 196 |
#2364 | santino | 196 |
#2365 | doc poke | 196 |
#2366 | Hirotrum | 195 |
#2367 | -blaze | 195 |
#2368 | DURTLE420 | 195 |
#2369 | WEEEE966 | 195 |
#2370 | Checkmate | 195 |
#2371 | -] K o Я n [- | 194 |
#2372 | Sloth ^ .^ | 194 |
#2373 | NikoBrasileira | 194 |
#2374 | Azrae1 | 194 |
#2375 | dAnY FlyNtZ >:) | 194 |
#2376 | Pooties_w | 193 |
#2377 | hen_sv | 193 |
#2378 | UnWise | 193 |
#2379 | -=(CottonSFM)=- | 193 |
#2380 | IntermitentArachnid | 192 |
#2381 | Asukarustic | 192 |
#2382 | Perrico | 192 |
#2383 | Ludisss | 191 |
#2384 | Kaneki_Slayer | 191 |
#2385 | Hatter | 191 |
#2386 | Ricota | 191 |
#2387 | GhospeMoth | 191 |
#2388 | Pepsi_Twist | 191 |
#2389 | Darky | 191 |
#2390 | pradomiguel592 | 190 |
#2391 | Cosmicmilk | 190 |
#2392 | marcio herobrine | 190 |
#2393 | mogged | 190 |
#2394 | bloodflowers | 189 |
#2395 | Kaliferno | 189 |
#2396 | Spoops(Owner of Sex.com) | 189 |
#2397 | pesto | 188 |
#2398 | nitagg | 188 |
#2399 | Priest of Scunts | 188 |
#2400 | El Malon traicionero | 188 |
#2401 | Tiny | 188 |
#2402 | Tipulalanou | 188 |
#2403 | NIGHTMINER121 | 188 |
#2404 | lendro | 188 |
#2405 | almost dying | 187 |
#2406 | Capotei o corsa | 187 |
#2407 | ItsMeArthurBrown | 187 |
#2408 | RetroCruz7 | 187 |
#2409 | tea_time | 187 |
#2410 | Hotdog Man | 186 |
#2411 | Into the Fires | 186 |
#2412 | Chris | 185 |
#2413 | isa | 185 |
#2414 | DuckOnRice | 185 |
#2415 | Rompchi | 184 |
#2416 | pabloohara29392 | 184 |
#2417 | Beandan the Bean | 184 |
#2418 | darth kermit the wise | 183 |
#2419 | rodjer96 | 183 |
#2420 | PDM | 183 |
#2421 | jayghost | 183 |
#2422 | renepojo tf2 | 183 |
#2423 | scot | 182 |
#2424 | Gario_Buttman | 182 |
#2425 | CNB Robo | 182 |
#2426 | N O P E | 182 |
#2427 | Luvcas | 182 |
#2428 | follamamis | 181 |
#2429 | misa | 181 |
#2430 | Haz | 181 |
#2431 | Baggin's | 181 |
#2432 | Zero_ | 180 |
#2433 | Ark | 180 |
#2434 | DOOMjabes | 180 |
#2435 | Aberth Skate | 179 |
#2436 | red | 179 |
#2437 | goregenic | 179 |
#2438 | kimblee | 179 |
#2439 | Amanda | 179 |
#2440 | Joaogab29 | 179 |
#2441 | those guys over there | 179 |
#2442 | Siqueiraguipro | 179 |
#2443 | VHS HDS02 | 178 |
#2444 | kz | 178 |
#2445 | benny | 178 |
#2446 | tuxedo | 178 |
#2447 | StoneOcean267 | 178 |
#2448 | bgr | 177 |
#2449 | Harvest is peak | 177 |
#2450 | Kay_Mid | 177 |
#2451 | yisuh | 177 |
#2452 | naoAli3n | 177 |
#2453 | Engineer Gaming | 176 |
#2454 | DOG WILL HUNT | 176 |
#2455 | xanacarnivora69 | 176 |
#2456 | ShoTgun | 176 |
#2457 | MILK Daddy | 176 |
#2458 | Gibus Medic | 175 |
#2459 | namorüm | 175 |
#2460 | Jyu | 175 |
#2461 | nikita.rasev | 175 |
#2462 | tor2vi | 175 |
#2463 | Beto Bullicio | 174 |
#2464 | gh0st_bandit | 174 |
#2465 | puraso | 174 |
#2466 | Camper | 173 |
#2467 | Herbert, não tão gente boa | 173 |
#2468 | C.A.M.P.E.R . | 173 |
#2469 | Scout Main | 173 |
#2470 | BatNoneBiney | 172 |
#2471 | ENZO | 172 |
#2472 | Keyos Emerl | 172 |
#2473 | mK | 171 |
#2474 | robvvrt | 171 |
#2475 | SEALwarrior60 | 170 |
#2476 | penislandia | 170 |
#2477 | the donker | 170 |
#2478 | Uncle Samsonite | 170 |
#2479 | Renan Ribeiro | 170 |
#2480 | shwn | 170 |
#2481 | Monkey87 | 170 |
#2482 | denzy_ | 169 |
#2483 | Olli | 169 |
#2484 | Dennis | 169 |
#2485 | MatiasLevel | 169 |
#2486 | Hayabusa | 169 |
#2487 | Big tree | 168 |
#2488 | misterlonly | 168 |
#2489 | Tsar_Mikail | 168 |
#2490 | Ryzin | 167 |
#2491 | Meowstal Dude | 167 |
#2492 | lcsduster | 167 |
#2493 | macarøni | 167 |
#2494 | Reaper ™ | 167 |
#2495 | ZELYNER | 167 |
#2496 | StoppingCow52000 | 166 |
#2497 | Moxxie45 | 166 |
#2498 | ponchitooo39 | 166 |
#2499 | lumpy_monkey | 166 |
#2500 | Eshyyyyy | 165 |
#2501 | CTRLhavoc | 165 |
#2502 | wildCricket | 165 |
#2503 | idk | 165 |
#2504 | Hydro UX | 165 |
#2505 | angel | 165 |
#2506 | karesha150912 | 165 |
#2507 | Snow | 165 |
#2508 | [TWL] Sloop Shit | 165 |
#2509 | Dragonite | 164 |
#2510 | Brotzio | 164 |
#2511 | Mia Baby | 164 |
#2512 | Xiaopang | 164 |
#2513 | MegaShine | 164 |
#2514 | naveisgone | 163 |
#2515 | rocco | 163 |
#2516 | hopelesskittens | 163 |
#2517 | tyep848 | 163 |
#2518 | Musclebound | 162 |
#2519 | Capivara | 162 |
#2520 | Leafeon Addict | 162 |
#2521 | onekleber | 162 |
#2522 | strike | 162 |
#2523 | Papacu | 162 |
#2524 | SAL'S PIZZARIA | 161 |
#2525 | geleia de uva | 161 |
#2526 | Noitakame | 161 |
#2527 | RAFA25kkk | 161 |
#2528 | drenn | 160 |
#2529 | Weed | 160 |
#2530 | Gabe Oytoucher | 160 |
#2531 | Edgyiel™ | 160 |
#2532 | EL MAGO-RDITO | 160 |
#2533 | FireTroop277 | 160 |
#2534 | Smag | 159 |
#2535 | Kat Beans | 159 |
#2536 | 1Sirian | 159 |
#2537 | Keiserwolf049 | 159 |
#2538 | gui | 159 |
#2539 | Pumpkin 南瓜 | 159 |
#2540 | Osama Bin Prockles | 159 |
#2541 | PinHeaad | 159 |
#2542 | Willy | 159 |
#2543 | Kartragos | 158 |
#2544 | Erysichthon | 158 |
#2545 | sewers | 158 |
#2546 | W.kk | 158 |
#2547 | Noob no Tf2 | 157 |
#2548 | TERRY R I H O | 157 |
#2549 | Mario the Liver Stealer | 157 |
#2550 | Emola Chipilis | 157 |
#2551 | L | 157 |
#2552 | zhaba1337 | 157 |
#2553 | John Gun Spy | 157 |
#2554 | Neyseajr | 157 |
#2555 | Mr. Pink | 156 |
#2556 | GingeNJuice | 156 |
#2557 | Snuffy | 156 |
#2558 | Golden | 156 |
#2559 | pudimbw5 | 156 |
#2560 | Mc Nugg | 156 |
#2561 | pandy fackler | 155 |
#2562 | liamAura | 155 |
#2563 | HvH Defender | 155 |
#2564 | Akira Flakes | 155 |
#2565 | salad | 155 |
#2566 | some guy | 155 |
#2567 | TheBonkBoy | 154 |
#2568 | heisenberg | 154 |
#2569 | Thiaguilson | 154 |
#2570 | DXMD | 154 |
#2571 | CreatorXP4 | 154 |
#2572 | shoeshine | 154 |
#2573 | haydnjlyew | 154 |
#2574 | joaco778 | 154 |
#2575 | GGGamer | 154 |
#2576 | King | 153 |
#2577 | Sr.Petrus | 153 |
#2578 | MC FAIL | 153 |
#2579 | crx- | 153 |
#2580 | parker***** | 152 |
#2581 | CleanGameCrash | 152 |
#2582 | theproxyjr | 151 |
#2583 | El indicado ;3 | 151 |
#2584 | zavask1 | 151 |
#2585 | boahancock | 151 |
#2586 | Xereco Supremo | 151 |
#2587 | EXE | 151 |
#2588 | 60140110eli | 150 |
#2589 | RB | 150 |
#2590 | fantesy238 | 150 |
#2591 | MIGU | 150 |
#2592 | O homem Zap zap | 150 |
#2593 | Dogey258 | 150 |
#2594 | MASTER CHIEF | 150 |
#2595 | declan | 149 |
#2596 | Critful | 149 |
#2597 | Impregnator9000 | 149 |
#2598 | ParrettGost | 149 |
#2599 | Quiver | 149 |
#2600 | nk.burrildo_11 | 149 |
#2601 | Knowlittle | 149 |
#2602 | VISION | 148 |
#2603 | MaxiGaming96 | 148 |
#2604 | muhammad.athoillah2014 | 148 |
#2605 | NaraUwU | 148 |
#2606 | Abicto | 147 |
#2607 | Smile Dog | 147 |
#2608 | skruub | 147 |
#2609 | bob | 147 |
#2610 | NegoDiValparaizo | 147 |
#2611 | The Damned Mouth | 147 |
#2612 | rafaelacarla123carlawi | 147 |
#2613 | don comedia | 147 |
#2614 | Luna :3 | 146 |
#2615 | yoshi | 146 |
#2616 | kawasaki | 146 |
#2617 | Herom | 146 |
#2618 | ColoRex | 146 |
#2619 | IcyBoi8776 | 146 |
#2620 | zardy | 146 |
#2621 | Heitor | 146 |
#2622 | Cakestarr | 146 |
#2623 | Mikh | 145 |
#2624 | Rozaju Colosso | 145 |
#2625 | Flipside | 144 |
#2626 | CΔNЄRS | 144 |
#2627 | Maienn | 144 |
#2628 | Tenebris | 144 |
#2629 | dom | 144 |
#2630 | spy crab | 143 |
#2631 | riso | 143 |
#2632 | Billy The Kid (SpOwOkyn't) | 143 |
#2633 | santi._.714 | 143 |
#2634 | Hiro Sora | 143 |
#2635 | Bango | 143 |
#2636 | nigga ate a bootyflake | 142 |
#2637 | CoughdropAddict | 142 |
#2638 | beekeeper | 142 |
#2639 | Santico | 142 |
#2640 | NationalPark2 | 142 |
#2641 | John Bones | 141 |
#2642 | Ph | 141 |
#2643 | skoget | 140 |
#2644 | behind791 | 140 |
#2645 | Quase Nada :D | 140 |
#2646 | xxcutexgodxx | 140 |
#2647 | ★®PajiN | 140 |
#2648 | Nobody | 140 |
#2649 | fluidcluess1209 | 140 |
#2650 | mattutix | 140 |
#2651 | Coballudo | 140 |
#2652 | arthur mitchell | 139 |
#2653 | mleon | 139 |
#2654 | ELD | 139 |
#2655 | deliofassheber | 139 |
#2656 | Pika de Yese | 139 |
#2657 | SarahB1914 | 139 |
#2658 | benjamin ulloa | 139 |
#2659 | Squidbilly | 139 |
#2660 | kevkev138 | 138 |
#2661 | Corvuz | 138 |
#2662 | CATNIP | 138 |
#2663 | señor josE | 138 |
#2664 | Cyn | 138 |
#2665 | Peperino | 137 |
#2666 | mascarado1232 | 137 |
#2667 | DodosDojo | 137 |
#2668 | SuinJIM | 137 |
#2669 | schkid | 136 |
#2670 | Arteduz | 136 |
#2671 | lankagayake | 136 |
#2672 | azizov0407 | 136 |
#2673 | NinjaGuerreiroBR | 136 |
#2674 | Maxax | 136 |
#2675 | aaronellion | 136 |
#2676 | you're gonna burn alright | 136 |
#2677 | Tyrant | 136 |
#2678 | Avraham | 136 |
#2679 | reversal | 135 |
#2680 | T rox | 135 |
#2681 | Moist Crackers | 135 |
#2682 | philsoyraptor | 134 |
#2683 | NoBrainAvailable | 134 |
#2684 | sundae maker | 134 |
#2685 | matthew_twigg | 134 |
#2686 | SWAMP SACK! | 134 |
#2687 | greg | 134 |
#2688 | pachi | 134 |
#2689 | Cbi Eijii | 134 |
#2690 | Plutarco | 134 |
#2691 | santinotarifa614 | 134 |
#2692 | Benderisgr834#FixTF2 | 134 |
#2693 | Alf28 | 134 |
#2694 | TUBERCULOSIS | 134 |
#2695 | Done | 133 |
#2696 | AaronWalkerRlz | 133 |
#2697 | Four4Gilgamesh (TRUMP) | 133 |
#2698 | juanDSL | 132 |
#2699 | the man of sex | 132 |
#2700 | ElqueteFOKA | 132 |
#2701 | dio | 132 |
#2702 | nayban gezebelle gaburgably fan | 132 |
#2703 | Cafézin Alemão | 132 |
#2704 | Eternal Blue | 132 |
#2705 | ejfirpo | 132 |
#2706 | KuRoi | 132 |
#2707 | (F2P) unhelpful engineer | 132 |
#2708 | Zonigo1.0 | 131 |
#2709 | R_E_B_E_L_A_D_O_R | 131 |
#2710 | SpaceVaqueiro | 131 |
#2711 | TheBreadTeleporter | 131 |
#2712 | Yo bro | 131 |
#2713 | piosdsa | 130 |
#2714 | ♛Opa! Uatahell♛ | 130 |
#2715 | NLE CHOPPA from TENNESSEE | 130 |
#2716 | i main spy engie and soldier | 130 |
#2717 | Ventro pie | 130 |
#2718 | willia | 130 |
#2719 | Dog | 130 |
#2720 | 66tekg 6 | 130 |
#2721 | Brigginshaw | 130 |
#2722 | Dross Fumando Un Pucho | 130 |
#2723 | elbow | 129 |
#2724 | CAPITAN PERUANO | 129 |
#2725 | dutch | 129 |
#2726 | Joel | 129 |
#2727 | absolem_2017 | 129 |
#2728 | Trade server F2p | 128 |
#2729 | Fewest | 128 |
#2730 | KeepLucky | 128 |
#2731 | Vash o estouro da boiada | 128 |
#2732 | Gabi | 128 |
#2733 | TheGuyOfCupcakes | 128 |
#2734 | Mari Kugisaki | 128 |
#2735 | CTRL's | 128 |
#2736 | Məðįç | 128 |
#2737 | The Honored One | 127 |
#2738 | Guaravito | 127 |
#2739 | gamboni8 | 127 |
#2740 | Chu (CS2 cuando me arme la pc ( | 127 |
#2741 | spidertom01 #fixtf2 | 127 |
#2742 | fentanylinhaler | 127 |
#2743 | demoman guy | 127 |
#2744 | Samecolour | 127 |
#2745 | Neko Industries | 127 |
#2746 | HλLF-LIFE Deathmatch: Source | 127 |
#2747 | carla | 127 |
#2748 | asaa | 127 |
#2749 | Hay que Mover el cacharro | 126 |
#2750 | monxak2010 | 126 |
#2751 | pedrosantos170800 | 126 |
#2752 | superzin | 126 |
#2753 | 25cartoons | 126 |
#2754 | Immature Soldier | 126 |
#2755 | Artur ✠ | 125 |
#2756 | rupt | 125 |
#2757 | Shisue | 125 |
#2758 | Kambalo | 125 |
#2759 | yurijamall | 124 |
#2760 | Mendigo dos Mares | 124 |
#2761 | Ryancaio | 124 |
#2762 | Mikey | 124 |
#2763 | gagos burgui | 124 |
#2764 | Tundra | 124 |
#2765 | not_boss_baby | 124 |
#2766 | AUDITOR DARKNESS | 124 |
#2767 | MarujoEn | 124 |
#2768 | Dépy | 123 |
#2769 | i love eating rocks :3 | 123 |
#2770 | JoseBrGames | 123 |
#2771 | Kek From Solar Dust Knights | 123 |
#2772 | oremoR nhoJ | 123 |
#2773 | zezin | 123 |
#2774 | mr_virtual2009 | 123 |
#2775 | C4ravaN | 123 |
#2776 | Hunter19351 | 123 |
#2777 | braincell | 123 |
#2778 | My Face | 122 |
#2779 | si | 122 |
#2780 | A_King_D0g | 122 |
#2781 | 2 fort tourist | 122 |
#2782 | Andrew | 122 |
#2783 | pablogonzalez2007 | 122 |
#2784 | December 8th. 1988. | 121 |
#2785 | ⋆Crowe⋆ | 121 |
#2786 | tankavel | 121 |
#2787 | MrTinSnips | 121 |
#2788 | GaelLH | 121 |
#2789 | datty | 120 |
#2790 | esqueleto comunista anti-otako | 120 |
#2791 | galostocchi | 120 |
#2792 | Pixel_DJ | 120 |
#2793 | mamadheydary7 | 120 |
#2794 | pierush | 120 |
#2795 | Bowser Juice | 119 |
#2796 | Hoovy main | 119 |
#2797 | La cariño(EihtSlowFlow) | 119 |
#2798 | MeatBeaterPRO | 119 |
#2799 | Ant Lion | 119 |
#2800 | eskimo1102003 | 119 |
#2801 | Devious Demoman | 118 |
#2802 | Thaumologist | 118 |
#2803 | FISH | 118 |
#2804 | Xx_SlimeTime_xX | 118 |
#2805 | MEGAANDROID | 118 |
#2806 | IncuboyD | 118 |
#2807 | SniX | 118 |
#2808 | scene girl gaming | 117 |
#2809 | ❤BunnyG3z_ | 117 |
#2810 | Sidius | 117 |
#2811 | kindertak | 117 |
#2812 | Nachi | 117 |
#2813 | Dick Trickle | 117 |
#2814 | Miner | 117 |
#2815 | Yuri doki doki literature club | 117 |
#2816 | KRATOS CORINTHIANS | 117 |
#2817 | KeenValue100Реальны | 117 |
#2818 | Arctic Anthrax | 117 |
#2819 | nicolas25919 | 117 |
#2820 | BSJ IAmSixSyllables | 116 |
#2821 | f1d3s | 116 |
#2822 | Ayoi | 116 |
#2823 | Martin_22 | 116 |
#2824 | Curica | 115 |
#2825 | Shaun Shenia | 115 |
#2826 | Peanut#fixtf2 | 115 |
#2827 | Ilovecatlandcentral!!! | 115 |
#2828 | carlos.eduardo0103 | 115 |
#2829 | WongTonNoodal | 115 |
#2830 | guy | 115 |
#2831 | mu | 114 |
#2832 | spooky rat | 114 |
#2833 | yyxysz | 114 |
#2834 | El empresario | 114 |
#2835 | Monke | 114 |
#2836 | illa D | 114 |
#2837 | Frosch | 114 |
#2838 | Cieron | 114 |
#2839 | LEOZIN DO ESMAGA | 114 |
#2840 | ianmatiasmoraalvarado13 | 114 |
#2841 | dpwfun629 | 114 |
#2842 | JackShadowHunter2317 | 114 |
#2843 | uh oh stinky | 114 |
#2844 | g3derrick | 114 |
#2845 | lucio333gamer | 114 |
#2846 | MrDMS | 113 |
#2847 | xablauuuuu | 113 |
#2848 | HmansORG | 113 |
#2849 | Smooth | 112 |
#2850 | don cakes | 112 |
#2851 | evil engineer | 112 |
#2852 | Snakeface | 112 |
#2853 | Petrivus | 112 |
#2854 | °*夢*° | 112 |
#2855 | Geezer Mcgee | 112 |
#2856 | Bird | 112 |
#2857 | pablitowo | 112 |
#2858 | shaw dey | 111 |
#2859 | SrScrop | 111 |
#2860 | RaviL | 111 |
#2861 | Yummy | 111 |
#2862 | CJ | 111 |
#2863 | ISNAIPER | 111 |
#2864 | xeron | 111 |
#2865 | That One Guy In The Corner | 111 |
#2866 | e1 | 111 |
#2867 | lina | 110 |
#2868 | robert the robber | 110 |
#2869 | LSauron | 110 |
#2870 | ColdChiknSoup | 110 |
#2871 | K0 | 110 |
#2872 | Cristiano Orlando | 110 |
#2873 | Mordiscox32 | 110 |
#2874 | amaramist_ | 109 |
#2875 | majesty | 109 |
#2876 | waiter: you vultures | 109 |
#2877 | elargentinoanimacion | 109 |
#2878 | joaquinalvarocorrea | 109 |
#2879 | Erthelgane | 108 |
#2880 | bizare | 108 |
#2881 | PERRO FANTASMA SOVIETICO | 108 |
#2882 | Tetonisher | 108 |
#2883 | tiny dick | 108 |
#2884 | Thauan09 | 107 |
#2885 | SICK EVIL MINDFLAYER!!!! | 107 |
#2886 | Tetrahydrocannabinol | 107 |
#2887 | Negricacao | 107 |
#2888 | Epiclegend234 | 107 |
#2889 | Squirtle | 107 |
#2890 | ★彡[ Mr.Mostache ]彡★ | 107 |
#2891 | Shundemburg | 107 |
#2892 | ladainha | 107 |
#2893 | Chutertf2cases.com | 107 |
#2894 | tino | 107 |
#2895 | confia po | 107 |
#2896 | alt_demo2905 | 107 |
#2897 | Wigglez | 107 |
#2898 | Finch | 107 |
#2899 | tako | 106 |
#2900 | Bumper cars are funny hahaha | 106 |
#2901 | ezsipnhd | 106 |
#2902 | ZeusFred | 106 |
#2903 | Minty | 106 |
#2904 | C0ULS0N | 106 |
#2905 | Bootleg Merasmus | 106 |
#2906 | $Thales$ | 106 |
#2907 | Kkkein007 | 106 |
#2908 | Boppin' my Flopper | 106 |
#2909 | hot pickles | 106 |
#2910 | motomarkens | 106 |
#2911 | Chocolate | 105 |
#2912 | Quinnard | 105 |
#2913 | Breno | 105 |
#2914 | Frank Gallagher | 105 |
#2915 | Curds | 105 |
#2916 | Unknown | 105 |
#2917 | vtto | 105 |
#2918 | Gnome | 105 |
#2919 | SpoopmasterX | 105 |
#2920 | puro_1477 | 105 |
#2921 | Once robux. | 104 |
#2922 | Afar | 104 |
#2923 | a.yussep19 | 104 |
#2924 | xxxrobloxxxcena | 104 |
#2925 | piolzin | 103 |
#2926 | gooning connoisseur | 103 |
#2927 | skp | 103 |
#2928 | Rul | 103 |
#2929 | kevinw.817 | 103 |
#2930 | The Tweaker | 103 |
#2931 | Mvtches | 103 |
#2932 | doug | 102 |
#2933 | Lrune | 102 |
#2934 | kjundvr | 102 |
#2935 | DUNNA | 102 |
#2936 | Wes Borland Holding A Rabbit | 101 |
#2937 | Mug | 101 |
#2938 | eve | 101 |
#2939 | MuriCouts | 101 |
#2940 | Stupid Kit ™ | 101 |
#2941 | Legend Of Hater | 101 |
#2942 | beardos | 101 |
#2943 | CreSpY | 101 |
#2944 | 76561199059538396 | 101 |
#2945 | pootis | 101 |
#2946 | マイシュ | 100 |
#2947 | Dudis23 | 100 |
#2948 | sex defender | 100 |
#2949 | Hjk | 100 |
#2950 | The Albanian Anarchist | 100 |
#2951 | The Gunslinger | 100 |
#2952 | The Lettuce Menace | 100 |
#2953 | dudez | 99 |
#2954 | miguezin#FixTF2 | 99 |
#2955 | ObungaYoChunga | 99 |
#2956 | ты идиот | 99 |
#2957 | ezrarg2012 | 99 |
#2958 | Masturbador de Araruama | 99 |
#2959 | Sharkteeth | 99 |
#2960 | SES | 99 |
#2961 | EletrikZ1 | 99 |
#2962 | VT Juan | 98 |
#2963 | xXSnowie420Xx | 98 |
#2964 | Dragblood | 98 |
#2965 | nextguy1117 | 98 |
#2966 | IDoodleStroodles | 97 |
#2967 | GiankiO | 97 |
#2968 | Gabriel Ga$pary | 97 |
#2969 | Sonicmariani181 | 97 |
#2970 | jungle bug | 97 |
#2971 | NationalPark | 97 |
#2972 | гусь с аватарки | 97 |
#2973 | fan de las empanadas | 97 |
#2974 | MarioVillain | 96 |
#2975 | Pizzadeabacate | 96 |
#2976 | brim | 95 |
#2977 | andriishulga1804 | 95 |
#2978 | Runo | 95 |
#2979 | Andsubm | 95 |
#2980 | jaybolt | 95 |
#2981 | leslypao | 95 |
#2982 | Duzz | 95 |
#2983 | KInovinhaKO | 95 |
#2984 | matias1062008 | 95 |
#2985 | Saint ★★★ | 94 |
#2986 | kinda tired | 94 |
#2987 | Ionic | 94 |
#2988 | Shall | 94 |
#2989 | BlazingTomato80 | 94 |
#2990 | hank | 94 |
#2991 | Loading... | 94 |
#2992 | EDU 神 | 94 |
#2993 | joao | 94 |
#2994 | :s/hello/hewwo/g | 94 |
#2995 | pumkinpatch | 94 |
#2996 | Romanzxl | 94 |
#2997 | hola puedo caer al baile asi? | 94 |
#2998 | led JR 15 | 93 |
#2999 | Didin | 93 |
#3000 | InsaneCharlo | 93 |
#3001 | kklukki06 | 93 |
#3002 | >>>> | 93 |
#3003 | JohnDeCockroach | 92 |
#3004 | SantiGuardianUniversalXD2#FixTF | 92 |
#3005 | The gibus achivus | 92 |
#3006 | Mortloaf | 92 |
#3007 | bakerman | 92 |
#3008 | The Spawn Creature | 91 |
#3009 | Vitin com teclado que nao é de | 91 |
#3010 | The guy from Fortnite | 91 |
#3011 | Dr. What | 91 |
#3012 | Normalmente | 91 |
#3013 | sallytrees | 91 |
#3014 | bowl | 91 |
#3015 | BlizzardWolfPK | 90 |
#3016 | jdtrgfeadvhyt | 90 |
#3017 | ata | 90 |
#3018 | ste3merteamer404 | 90 |
#3019 | rauhenrique7 | 90 |
#3020 | L1NkM0Ght | 90 |
#3021 | Still Gamin | 90 |
#3022 | demo golfer | 90 |
#3023 | VarietyGaming | 90 |
#3024 | Gustashy | 90 |
#3025 | Raiden4/30 | 90 |
#3026 | Mafia | 89 |
#3027 | Hikm | 89 |
#3028 | cauvodecria297 | 89 |
#3029 | BielzinhoXD |#Espião#| | 89 |
#3030 | annonymous789 | 89 |
#3031 | LeahMK | 89 |
#3032 | robertmelendez287 | 89 |
#3033 | koala | 89 |
#3034 | < blank > | 89 |
#3035 | CrisstheWize | 89 |
#3036 | I can't aim | 89 |
#3037 | UnLuKyxXXx | 89 |
#3038 | pubert jhonson 425 | 89 |
#3039 | ∞ | 88 |
#3040 | axioma | 88 |
#3041 | h4wk | 88 |
#3042 | Tu padre es el negro José | 88 |
#3043 | Aniki | 88 |
#3044 | niedjonsoares1987 | 88 |
#3045 | KR00M | 88 |
#3046 | Malinka | 88 |
#3047 | kirillpopiob | 88 |
#3048 | Marshal Marcellus | 88 |
#3049 | IanSim2 | 87 |
#3050 | BackstabSpy | 87 |
#3051 | donio | 87 |
#3052 | Rouba_Brisa | 87 |
#3053 | SR. BANANA | 87 |
#3054 | ice eater | 87 |
#3055 | hashtop | 87 |
#3056 | DJ CHILENO | 87 |
#3057 | ClapTrap | 87 |
#3058 | JonyDany12 | 87 |
#3059 | Reclaimed metal gaming | 87 |
#3060 | Ghostly | 86 |
#3061 | EureCrit Effect | 86 |
#3062 | Jaotaro_Bujao | 86 |
#3063 | P3dradaxx | 86 |
#3064 | Boboleta | 86 |
#3065 | Yese de Pika | 86 |
#3066 | Trickster06 | 86 |
#3067 | Max Box | 86 |
#3068 | rat | 86 |
#3069 | Mathew T. Nelson | 86 |
#3070 | robloxlover2015 | 85 |
#3071 | Sr.Sky | 85 |
#3072 | Tilapia de Frango | 85 |
#3073 | hawkiby1300 | 85 |
#3074 | nathaniel15183966 | 85 |
#3075 | Iggy | 85 |
#3076 | EXPoteer | 85 |
#3077 | BRIλN MADNESS | 84 |
#3078 | [we dont know] | 84 |
#3079 | Greg | 84 |
#3080 | nemonstruoso | 84 |
#3081 | E | 84 |
#3082 | A horror movie fan | 84 |
#3083 | chiwykun2017 | 84 |
#3084 | F1lthy | 83 |
#3085 | Monumntlshrimp3 | 83 |
#3086 | mopssssssss | 83 |
#3087 | dinosaur toothbrush | 83 |
#3088 | wesley | 83 |
#3089 | pickleknotts [DEAD] | 82 |
#3090 | john matrix | 82 |
#3091 | MOST TOXIC MVM PLAYER | 82 |
#3092 | DRAKE | 82 |
#3093 | †|Paranoid|†™ | 82 |
#3094 | Hedohein | 82 |
#3095 | Noxius | 82 |
#3096 | XFLR5 Direct Foil Analysis | 82 |
#3097 | The f2p | 82 |
#3098 | jirkasl8 | 82 |
#3099 | RealPerson_303 | 82 |
#3100 | las mujeres me dan miedo... | 81 |
#3101 | _sXimik | 81 |
#3102 | Pyrozxywq | 81 |
#3103 | Lerm | 81 |
#3104 | Lynx | 81 |
#3105 | Big boss | 81 |
#3106 | Idon'tknowwhatmyusernamewillbe | 81 |
#3107 | ticktiger | 81 |
#3108 | ludovico | 80 |
#3109 | Vivinator | 80 |
#3110 | TyrantJaeger | 80 |
#3111 | ignacioyoichi | 80 |
#3112 | Minionfan105 | 80 |
#3113 | Pigment | 80 |
#3114 | Emperor of Mankind(Real) | 79 |
#3115 | Padreso | 79 |
#3116 | EL LØbØ | 79 |
#3117 | rubrusraskol | 79 |
#3118 | onlymarcos | 79 |
#3119 | palagizz. | 79 |
#3120 | dpac | 78 |
#3121 | Jinx | 78 |
#3122 | Leonzitt | 78 |
#3123 | Sinno | 78 |
#3124 | BeeATree | 78 |
#3125 | Fideo Cocina | 78 |
#3126 | Necro | 78 |
#3127 | cuebana82 | 78 |
#3128 | zephy | 78 |
#3129 | SW | 78 |
#3130 | wasdmero | 78 |
#3131 | scolax19 | 78 |
#3132 | Lich of Hearts | 77 |
#3133 | Raven_7 | 77 |
#3134 | toastboy26 | 77 |
#3135 | feetusdeletus12x | 77 |
#3136 | Pandora | 77 |
#3137 | [rodney] | 77 |
#3138 | Fellow Rabbit | 77 |
#3139 | gosto de cavalos | 77 |
#3140 | Glamour | 76 |
#3141 | Toaster Chicken | 76 |
#3142 | fishu | 76 |
#3143 | Crespo 2.0 | 76 |
#3144 | slender13561 | 76 |
#3145 | stfunig | 76 |
#3146 | paulmaster | 76 |
#3147 | zenta | 76 |
#3148 | violet | 75 |
#3149 | alves | 75 |
#3150 | LLama | 75 |
#3151 | Bendox_47 | 75 |
#3152 | erastik970 | 75 |
#3153 | MILEI,MATE A LOS JUBILADOS | 75 |
#3154 | freebirdsolospinningrat | 75 |
#3155 | Johnny Cheddar | 75 |
#3156 | -R E V Y A S- | 75 |
#3157 | BLUEFUZE | 75 |
#3158 | minipenuin | 74 |
#3159 | tostycruncher | 74 |
#3160 | tumad_ | 74 |
#3161 | Schizophrenio | 74 |
#3162 | Russian comrade | 74 |
#3163 | theCaptain1945 | 74 |
#3164 | hikikomori | 74 |
#3165 | Espirola | 74 |
#3166 | [PCMR] Tizaki | 73 |
#3167 | Hollic | 73 |
#3168 | AgustinFornite2014 | 73 |
#3169 | Pretty Girls Make Graves | 73 |
#3170 | bruno bannany | 73 |
#3171 | Creepy PeePee | 73 |
#3172 | not_cyan | 73 |
#3173 | belucho24 | 73 |
#3174 | Свофорд | 73 |
#3175 | protojoao7 | 73 |
#3176 | artillero312 | 73 |
#3177 | huzz_obliterator | 72 |
#3178 | Śliwson | 72 |
#3179 | lump | 72 |
#3180 | soap | 72 |
#3181 | Coffee Sniffler #FixTF2 | 72 |
#3182 | WARIO-EL-PIJ4-G0RD4-Y-FL4CIDA | 72 |
#3183 | HAXE | 72 |
#3184 | Schuh | 72 |
#3185 | Diesel Doctor | 72 |
#3186 | starypios | 72 |
#3187 | raimundos só no forevis | 72 |
#3188 | ToonsAnimations | 72 |
#3189 | CHIPPS | 71 |
#3190 | oliver.clay | 71 |
#3191 | Cabeça de Benga | 71 |
#3192 | CharlyCHR | 71 |
#3193 | Modrinth | 71 |
#3194 | lord pyro | 71 |
#3195 | elvtpobre | 71 |
#3196 | LeoLinkBR | 71 |
#3197 | GibusGamer | 71 |
#3198 | Sonic573 | 71 |
#3199 | Skull Knight | 71 |
#3200 | Belo | 70 |
#3201 | Annonymouss_ | 70 |
#3202 | paloma dripp | 70 |
#3203 | Nick | 70 |
#3204 | MatCzz | 70 |
#3205 | слощавая крыса | 70 |
#3206 | Bones Malone | 70 |
#3207 | 4finger | 70 |
#3208 | vsam5449 | 70 |
#3209 | papershowdown #SAVE TF2 | 70 |
#3210 | TheLordAsher | 70 |
#3211 | > Sauce | 70 |
#3212 | MiM'd | 70 |
#3213 | Maicena | 70 |
#3214 | Terry Wrist | 70 |
#3215 | pizdasus20 | 70 |
#3216 | THE HONEYBUN HOBGOBLER | 69 |
#3217 | zhavrid1985 | 69 |
#3218 | peepeepoopoo | 69 |
#3219 | SirMixirica123 | 69 |
#3220 | Nazdrovie | 69 |
#3221 | Ongongamt | 69 |
#3222 | Major Tom | 69 |
#3223 | Violet | 68 |
#3224 | Mikans_Flaggy | 68 |
#3225 | Medic inútil | 68 |
#3226 | Gray | 68 |
#3227 | Pedronetolis | 68 |
#3228 | MINI FALLEN | 68 |
#3229 | KENNY!!! (Lesbian) | 68 |
#3230 | Shinnok | 68 |
#3231 | MelettiLestrade | 68 |
#3232 | X.N.X.X | 68 |
#3233 | Vulgar Display of Power (1992) | 67 |
#3234 | Dalenology | 67 |
#3235 | marcio petrobras | 67 |
#3236 | Skemly | 67 |
#3237 | Moron | 67 |
#3238 | Tomaseitor Salineitor 0274 | 67 |
#3239 | El' Piano | 67 |
#3240 | Scythe | 66 |
#3241 | Emasarix | 66 |
#3242 | blackjet15 | 66 |
#3243 | Weavy | 66 |
#3244 | DaviW | 66 |
#3245 | Pherrret | 66 |
#3246 | קєяℓιχ (Perlix) | 66 |
#3247 | Drigs #femboy | 66 |
#3248 | H.E.A.V.Y | 66 |
#3249 | Krewer | 65 |
#3250 | Sherlock | 65 |
#3251 | CritiSanguche | 65 |
#3252 | ^.^ | 65 |
#3253 | Sylas | 65 |
#3254 | Piva | 65 |
#3255 | Twin Cores | 65 |
#3256 | ianzito | 65 |
#3257 | Take.it.Eazy | 65 |
#3258 | vicentes19 | 65 |
#3259 | Lazy Broadcasts She/Her | 64 |
#3260 | tatox1309 | 64 |
#3261 | Luc4stello | 64 |
#3262 | joaopaulo | 64 |
#3263 | Demothers | 64 |
#3264 | :p | 64 |
#3265 | Purge With Fire | 64 |
#3266 | vaceslavukraincev886 | 64 |
#3267 | Comrade Weary | 64 |
#3268 | Tinga Tava | 64 |
#3269 | flamewheelTF | 64 |
#3270 | MACSPY XD | 64 |
#3271 | DORN | 64 |
#3272 | hopeless_nugget | 63 |
#3273 | magnataplaying | 63 |
#3274 | Horizen | 63 |
#3275 | Gusta-0 | 63 |
#3276 | amit | 63 |
#3277 | Kaza | 63 |
#3278 | JAN | 63 |
#3279 | TravelingLucario | 63 |
#3280 | WeirdFishArpeggi | 63 |
#3281 | j | 62 |
#3282 | Professor_Soulless | 62 |
#3283 | twistedillusion #fixtf2 | 62 |
#3284 | Spongebob scarepants | 62 |
#3285 | civilized | 62 |
#3286 | Bellrockss | 62 |
#3287 | |-Gustavo-| | 62 |
#3288 | EagleScoutGamer | 62 |
#3289 | sebaz890 | 62 |
#3290 | Jubi | 62 |
#3291 | psycho octopus | 62 |
#3292 | Supper Man | 61 |
#3293 | only a fool would say that | 61 |
#3294 | lilsanco | 61 |
#3295 | CANTINA | 61 |
#3296 | Samuel Valentim | 61 |
#3297 | ssayler1156 | 61 |
#3298 | Insane Lunatic | 61 |
#3299 | RandomPlayer | 61 |
#3300 | gabriel.ta.augusto | 61 |
#3301 | sullivan.noah | 61 |
#3302 | felipemaneiro | 61 |
#3303 | Choledo41 | 61 |
#3304 | the bronze age | 61 |
#3305 | Brine Griffin | 60 |
#3306 | lasanha | 60 |
#3307 | PEDRO | 60 |
#3308 | Trainbrain2343 | 60 |
#3309 | braydencraig602 | 60 |
#3310 | chenstaa | 60 |
#3311 | funny | 60 |
#3312 | miguel | 60 |
#3313 | Buvuw | 60 |
#3314 | FancierCarp6701 | 60 |
#3315 | soldier | 60 |
#3316 | Where The Blow At | 60 |
#3317 | cymug | 60 |
#3318 | bookreader | 59 |
#3319 | ne0n | 59 |
#3320 | Professional Killstreak Dumbass | 59 |
#3321 | Rei Cobra Boladão | 59 |
#3322 | SquareDorito | 59 |
#3323 | Doffy | 59 |
#3324 | lagarto | 59 |
#3325 | alucard | 59 |
#3326 | KenthSMD | 59 |
#3327 | Borba75 | 59 |
#3328 | TThor907 | 59 |
#3329 | Gh0stTrapped:/ | 59 |
#3330 | Pina | 59 |
#3331 | ZzZamoYY56 | 58 |
#3332 | miqueas0_0 | 58 |
#3333 | edrt | 58 |
#3334 | myersjedarmy | 58 |
#3335 | depressed pyro | 58 |
#3336 | lander | 58 |
#3337 | KENNY | 58 |
#3338 | gallardoguerrero16 | 58 |
#3339 | Ka-boooom! | 58 |
#3340 | GOOD | 58 |
#3341 | Angel Miller | 58 |
#3342 | jão | 58 |
#3343 | Woodstock | 58 |
#3344 | BrineyBat | 57 |
#3345 | arl | 57 |
#3346 | happy place | 57 |
#3347 | hammersickle59 | 57 |
#3348 | Zambotisexual | 57 |
#3349 | Augustogamer77 | 57 |
#3350 | BluddLust | 57 |
#3351 | Vlad Kowacs | 57 |
#3352 | nemo | 57 |
#3353 | Andrew | 57 |
#3354 | MEGA/DEER | 57 |
#3355 | aye, me bottle o' scrumpey | 57 |
#3356 | j63285040 | 56 |
#3357 | martyhickey | 56 |
#3358 | SeaGallGames | 56 |
#3359 | SONECA | 56 |
#3360 | locomueto | 56 |
#3361 | treeslime | 56 |
#3362 | The Shepherd | 56 |
#3363 | KingSplash375 | 56 |
#3364 | Royal Rumpus | 56 |
#3365 | the fart | 56 |
#3366 | smithrc99 | 56 |
#3367 | _Digested_Alpaca_(TG)_ | 56 |
#3368 | NOFI | 56 |
#3369 | Error Shark | 56 |
#3370 | murrayuriah15 | 56 |
#3371 | tecnoblack | 56 |
#3372 | No Enemies | 55 |
#3373 | starlynjavierc | 55 |
#3374 | Heretic | 55 |
#3375 | bautiriva2020 | 55 |
#3376 | UAHSD+.CFG | 55 |
#3377 | Droggi | 55 |
#3378 | 1993 Yamaha DT 180 Z | 55 |
#3379 | lenda jovem | 55 |
#3380 | crims0n | 55 |
#3381 | Doug | 55 |
#3382 | tijgerye | 55 |
#3383 | Alon | 54 |
#3384 | The First DemoKnight | 54 |
#3385 | ✙Komyos✙ | 54 |
#3386 | Epic.MP4w | 54 |
#3387 | Noponz | 54 |
#3388 | Moonlight | 54 |
#3389 | sarcofago! | 54 |
#3390 | BIGPARKAS | 54 |
#3391 | Urso Cone | 54 |
#3392 | Damishoro | 54 |
#3393 | _Hammerite_ | 54 |
#3394 | mack.2009 | 54 |
#3395 | OColombo | 54 |
#3396 | MMD-REZA | 54 |
#3397 | Kyle Speed | 54 |
#3398 | bum farter 4 | 54 |
#3399 | L4WN-M0W3R | 53 |
#3400 | proudly insane | 53 |
#3401 | Don Pichulaso | 53 |
#3402 | liort | 53 |
#3403 | KR00ZN5 | 53 |
#3404 | esBozzo | 53 |
#3405 | SPRINGBOI | 53 |
#3406 | JuegosDeTractores.com | 53 |
#3407 | sassy | 52 |
#3408 | Aiza | 52 |
#3409 | kennonpalfrey98 | 52 |
#3410 | kova | 52 |
#3411 | I BLEW UP THE TOILET | 52 |
#3412 | DAY21 | 52 |
#3413 | daryankie0 | 52 |
#3414 | rosa | 52 |
#3415 | gudu35443 | 52 |
#3416 | M_Y_ILOVEYOU | 52 |
#3417 | . | 51 |
#3418 | HllllIllllll | 51 |
#3419 | MO | 51 |
#3420 | Mordor | 51 |
#3421 | zifontech02 | 51 |
#3422 | Grifter | 51 |
#3423 | Macaroni96 | 51 |
#3424 | Sheridan | 51 |
#3425 | The_Grill_Master | 51 |
#3426 | lil durk atlanta | 50 |
#3427 | cronicamente online | 50 |
#3428 | Gu_Mi-llianos:) | 50 |
#3429 | Saul Pissman | 50 |
#3430 | Joa | 50 |
#3431 | MaXValen | 50 |
#3432 | SilentResident09 | 50 |
#3433 | Grimmer | 50 |
#3434 | DragonBloodz | 50 |
#3435 | Mohammed_yd | 50 |
#3436 | psycho octopus | 50 |
#3437 | Scout | 50 |
#3438 | 3r4 | 50 |
#3439 | SynisterCrow | 50 |
#3440 | PORTAL69 | 50 |
#3441 | Suri ¡! ❀ | 49 |
#3442 | Wayne | 49 |
#3443 | not ChatGPT | 49 |
#3444 | Mafer | 49 |
#3445 | DontKillMe | 49 |
#3446 | urinal shit | 49 |
#3447 | Thomas Jefferson | 49 |
#3448 | Salty Sniper | 49 |
#3449 | umboy | 49 |
#3450 | Medic_gaming | 49 |
#3451 | DoesΗotter | 49 |
#3452 | DR4NGD_BEAST | 49 |
#3453 | сэрCaptainFufflypants | 49 |
#3454 | Fancy The (She/Her) | 49 |
#3455 | James Murphy | 49 |
#3456 | Lacaio | 49 |
#3457 | Jesus Christ | 48 |
#3458 | cowboy guy number 203 | 48 |
#3459 | Edelweiss | 48 |
#3460 | chau | 48 |
#3461 | cssiowgst | 48 |
#3462 | Leogamertmj | 48 |
#3463 | Dum | 48 |
#3464 | edible fiji water bottle | 48 |
#3465 | [Taag]Storm{AL} The Engi | 48 |
#3466 | Tchélvis Podre | 47 |
#3467 | Siri (fazendo barra) | 47 |
#3468 | 足が付く | 47 |
#3469 | Lula Gaming | 47 |
#3470 | DJSMITH | 47 |
#3471 | Thiaguinho | 47 |
#3472 | alanokys | 47 |
#3473 | B0izer | 47 |
#3474 | Glorified Butter | 47 |
#3475 | Saxton Hale | 47 |
#3476 | Minzky | 47 |
#3477 | Lenovo IdeaPad S340-15IIL | 47 |
#3478 | чел гриди блет | 47 |
#3479 | Mike Ross | 46 |
#3480 | LinedScarab9174 | 46 |
#3481 | The Kisser of Boys | 46 |
#3482 | lardbuckets | 46 |
#3483 | Lisa | 46 |
#3484 | Bongo Master | 46 |
#3485 | Rafaelinsano24(F2P) | 46 |
#3486 | yaffe.yuval | 46 |
#3487 | edu | 46 |
#3488 | lemme get a tuah the hawky way | 46 |
#3489 | Mr. Bones | 46 |
#3490 | El Mejor Random :) | 46 |
#3491 | DhenO | 46 |
#3492 | Jamthewham | 46 |
#3493 | Tommi | 46 |
#3494 | GOBlINMANGOBLINMAN!!!!!!! | 46 |
#3495 | rip lusi | 46 |
#3496 | itsuki.hirata | 46 |
#3497 | Camoern | 45 |
#3498 | JustChester | 45 |
#3499 | Trx | 45 |
#3500 | Heaven | 45 |
#3501 | PIMP IN DISCRESS | 45 |
#3502 | JS | 45 |
#3503 | pedroks10004 | 45 |
#3504 | FUNNYMAN187 | 45 |
#3505 | FlatCapNoah | 45 |
#3506 | faceless badge | 45 |
#3507 | ltgonzalez | 45 |
#3508 | Mauiep | 45 |
#3509 | Alobo | 45 |
#3510 | ban em | 44 |
#3511 | PepeLePeuf | 44 |
#3512 | Mr. funny looking | 44 |
#3513 | Frykid Jr | 44 |
#3514 | Frost | 44 |
#3515 | NERO | 44 |
#3516 | ⓦ_Mrojosan_ⓦ | 44 |
#3517 | Vcent_IZ® | 44 |
#3518 | Soup dweller | 44 |
#3519 | Zlatan Ibrahimovic | 44 |
#3520 | jackiwi143 | 44 |
#3521 | Assmonkey2000 | 43 |
#3522 | John Medicine | 43 |
#3523 | Zayah | 43 |
#3524 | Zapper Man | 43 |
#3525 | T19 | 43 |
#3526 | Asafe | 43 |
#3527 | SameHalloweenGuy | 43 |
#3528 | Ninten | 43 |
#3529 | Memes Dieguito | 43 |
#3530 | Hoodoo | 43 |
#3531 | Cusse Tinha | 43 |
#3532 | Muck Machine | 43 |
#3533 | gravel shit #muteF2P | 42 |
#3534 | allanoot | 42 |
#3535 | Darth Fred the Maulester | 42 |
#3536 | ragnarokmanabat | 42 |
#3537 | {DT}SpaceKitten<3 | 42 |
#3538 | gubby | 42 |
#3539 | antoniomello690 | 42 |
#3540 | str4nded | 42 |
#3541 | AceBahamut | 42 |
#3542 | satorugojovsukuna | 42 |
#3543 | Esso Man | 42 |
#3544 | Gel0 | 42 |
#3545 | arthur909 | 42 |
#3546 | RainyOSX | Tf2cases.com | 42 |
#3547 | Otter`s_Ass | 42 |
#3548 | IN ํSTORES NOVEMBER 13TH | 42 |
#3549 | Schädel | 42 |
#3550 | rata/hacker/2001/1982 | 42 |
#3551 | The Average Bloke | 42 |
#3552 | EG!! | 42 |
#3553 | ColtonVR | 42 |
#3554 | Mr. Guder | 41 |
#3555 | Edgard | 41 |
#3556 | Mozeiszz | 41 |
#3557 | LyNx | 41 |
#3558 | {ViP}Dj-Culture [1Million] | 41 |
#3559 | Freebird | 41 |
#3560 | test dummy | 41 |
#3561 | realloay100 | 41 |
#3562 | ΞJugaslavΞ [F2P] | 41 |
#3563 | Dark | 41 |
#3564 | The | 40 |
#3565 | :3 | 40 |
#3566 | Mini_JJ | 40 |
#3567 | Pluto-234 | 40 |
#3568 | yeatcom | 40 |
#3569 | がんばれ よ | 40 |
#3570 | | KhalysHalo | | 40 |
#3571 | kzk MODO CHIDO | 40 |
#3572 | can screen | 40 |
#3573 | Ben Dover | 40 |
#3574 | dudeward13 | 40 |
#3575 | джигит | 40 |
#3576 | BP | 40 |
#3577 | stella | 40 |
#3578 | kenyérhal | 40 |
#3579 | Szódavíz | 40 |
#3580 | brazzers. | 40 |
#3581 | ShreksHellraiser | 40 |
#3582 | olivia :b | 39 |
#3583 | MATWECH | 39 |
#3584 | jsoforfun | 39 |
#3585 | -=Bits=-Dinkleberg | 39 |
#3586 | Claroscuro | 39 |
#3587 | froqqqy | 39 |
#3588 | CamManx | 39 |
#3589 | M4theus | 39 |
#3590 | davidsaulo123 | 39 |
#3591 | mr poopoo pants | 39 |
#3592 | kjay11314 | 39 |
#3593 | TodDoritOS ******** | 39 |
#3594 | Pyro | 39 |
#3595 | eye of cthulu plush | 38 |
#3596 | Plashe | 38 |
#3597 | Kris | 38 |
#3598 | Larry | 38 |
#3599 | Lak II | 38 |
#3600 | Ari ♥ | 38 |
#3601 | el_cayetanox_14 | 38 |
#3602 | GUMMY BEํAR | 38 |
#3603 | Mari | 38 |
#3604 | Luigi Is Real | 38 |
#3605 | Fat Bastard | 38 |
#3606 | Dabledos #TF2EASY | 38 |
#3607 | Waffles | 38 |
#3608 | heavy maquiavélico dantesco | 37 |
#3609 | BanasRPG | 37 |
#3610 | GIOTHEWATRMELONKING#HamMafia | 37 |
#3611 | Z_ZACK_18 | 37 |
#3612 | jogo do pão | 37 |
#3613 | Just a Guy | 37 |
#3614 | DJMarshall19 | 37 |
#3615 | ♦ BRASA ♦ | 37 |
#3616 | redoxgaming | 37 |
#3617 | [SrK] Véi | 37 |
#3618 | Chinese Dog | 37 |
#3619 | Chalengin Charlaton | 37 |
#3620 | Elias | 37 |
#3621 | classens | 37 |
#3622 | hugobogosse666 | 37 |
#3623 | Blaze! | 37 |
#3624 | eddie | 37 |
#3625 | Gav | 37 |
#3626 | OBLIVION | 36 |
#3627 | kesu9 | 36 |
#3628 | HollowIRL | 36 |
#3629 | Prossi | 36 |
#3630 | Cavalildo99 | 36 |
#3631 | miguelito | 36 |
#3632 | FantasySR | 36 |
#3633 | ✞✞Nebožiec✞✞ | 36 |
#3634 | butterthief | 36 |
#3635 | thomas | 36 |
#3636 | xxx_don_francisco_xxx | 36 |
#3637 | MackDaddy | 35 |
#3638 | Opala 85 | 35 |
#3639 | sodaboi | 35 |
#3640 | Garoto Brasileiro | 35 |
#3641 | Picolé de Batata Doce | 35 |
#3642 | Gustavocoste | 35 |
#3643 | SoldierOfDeath | 35 |
#3644 | MOMAZOS JUAN | 35 |
#3645 | CamT | 35 |
#3646 | jq7172 | 35 |
#3647 | TimeBucket | 35 |
#3648 | Engineer | 35 |
#3649 | rina | 35 |
#3650 | lulipe_10 | 35 |
#3651 | emigamersepulveda | 35 |
#3652 | theHybrid | 35 |
#3653 | XxTom_&_JerryxX | 35 |
#3654 | GoobilyGoobster | 35 |
#3655 | szef_kuchni34 | 35 |
#3656 | Cowtastic | 34 |
#3657 | tj | 34 |
#3658 | Emmi01 | 34 |
#3659 | Tralf Hardy | 34 |
#3660 | Criptical | 34 |
#3661 | FFtF MK. Vltra | 34 |
#3662 | 40masteee | 34 |
#3663 | bubba | 34 |
#3664 | MamakoPrimata | 34 |
#3665 | Daddy Bruce | 34 |
#3666 | Camilon Comilon | 34 |
#3667 | Big Whiskey | 34 |
#3668 | NIGHTMARE1335 | 34 |
#3669 | FZtiti | 34 |
#3670 | SANGUCHE #UnMuteF2P | 33 |
#3671 | zHex | 33 |
#3672 | RuMpOl | 33 |
#3673 | lu | 33 |
#3674 | thomate143 | 33 |
#3675 | coachfrenchy1 | 33 |
#3676 | Darknight | 33 |
#3677 | DAT | 33 |
#3678 | Deviousorange2732 | 33 |
#3679 | StarPugs | 33 |
#3680 | TiKimba | 33 |
#3681 | ArodePollo | 33 |
#3682 | Ann killer | 33 |
#3683 | Ronindriv | 33 |
#3684 | muclarobr2020 | 33 |
#3685 | monkeydoodoo2 | 32 |
#3686 | ampere | 32 |
#3687 | elli | 32 |
#3688 | Brother | 32 |
#3689 | mg11a3 | 32 |
#3690 | KAISER YOUNKO | 32 |
#3691 | silly twink (medic) | 32 |
#3692 | tav sch | 32 |
#3693 | Alex | 32 |
#3694 | Mike O'Hearn | 32 |
#3695 | mikedreemur | 32 |
#3696 | James | 32 |
#3697 | bernardomo13.2 | 32 |
#3698 | Icewarrior | 32 |
#3699 | Sir Wilford IV | 32 |
#3700 | Samuel Fidelis.br97 | 32 |
#3701 | Rei Scarlate | 32 |
#3702 | el jeres | 32 |
#3703 | blade7110 | 32 |
#3704 | Barely Random | 31 |
#3705 | Mr.Griimm | 31 |
#3706 | Amowlm | 31 |
#3707 | Kue | 31 |
#3708 | julien donkey boy | 31 |
#3709 | mundy | 31 |
#3710 | arn00ld | 31 |
#3711 | ♡ Emu Otori ✨❤ | 31 |
#3712 | wonkamin6 | 31 |
#3713 | Hex | 31 |
#3714 | el calvo | 31 |
#3715 | O Chang KK | 31 |
#3716 | Kelper | 31 |
#3717 | Trinth | 31 |
#3718 | nycollaseduardo2025 | 31 |
#3719 | ARC | 31 |
#3720 | Swog | 31 |
#3721 | goribby | 31 |
#3722 | Licky Lee | 30 |
#3723 | Frasier | 30 |
#3724 | One-Man Cheeseburger Apocalypse | 30 |
#3725 | Spyglass | 30 |
#3726 | dumbass | 30 |
#3727 | Chanito | 30 |
#3728 | Star | 30 |
#3729 | Poochie | 30 |
#3730 | FreeIvig557 | 30 |
#3731 | Dekas2832 | 30 |
#3732 | §♠_Matheus_♠§ | 30 |
#3733 | unknown | 30 |
#3734 | Pudingg28 | 30 |
#3735 | Mr_Alen2504 | 30 |
#3736 | raldite | 30 |
#3737 | THE EMA | 30 |
#3738 | MrKit | 30 |
#3739 | cornerstab | 30 |
#3740 | Julian | 30 |
#3741 | Pedro_ | 30 |
#3742 | North | 30 |
#3743 | Mysti_BL4D3 | 30 |
#3744 | Peter Griffin ASMR | 30 |
#3745 | Peshmerga. | 30 |
#3746 | tguy | 30 |
#3747 | Twister | 29 |
#3748 | GrimComic1 | 29 |
#3749 | dudi | 29 |
#3750 | $uicide $hark | 29 |
#3751 | Dooodle | 29 |
#3752 | ThatOneBlonde | 29 |
#3753 | Saul Goodman | 29 |
#3754 | VerRain #EVR | 29 |
#3755 | ! Skelly | 29 |
#3756 | +++ | 29 |
#3757 | xgian_n18 | 29 |
#3758 | catra69 | 29 |
#3759 | SK_Mr.Brazino | 29 |
#3760 | Solo | 29 |
#3761 | Lsaque | 29 |
#3762 | Eki | 29 |
#3763 | Rafti | 29 |
#3764 | Genezis | 29 |
#3765 | sebatian gaming | 29 |
#3766 | хз | 29 |
#3767 | scout gaming | 29 |
#3768 | Visix | 29 |
#3769 | Sex_Fortress | 29 |
#3770 | Ghost^Peaks | 29 |
#3771 | dawgman | 29 |
#3772 | bustawwww | 28 |
#3773 | mnster | 28 |
#3774 | milanguche (halloween version) | 28 |
#3775 | ∆ | 28 |
#3776 | Nite | 28 |
#3777 | yi | 28 |
#3778 | Kactus | 28 |
#3779 | Henzo | 28 |
#3780 | whiczzzikadobaile.XIT SMURF | 28 |
#3781 | revcna1 | 28 |
#3782 | yippeeee522 | 28 |
#3783 | aspectr | 28 |
#3784 | atm | 27 |
#3785 | malus20 | 27 |
#3786 | B'sB | Faca Tramontina | 27 |
#3787 | lookin CUTE in my jammies | 27 |
#3788 | melby law | 27 |
#3789 | rojblue | 27 |
#3790 | LeoLeShea | 27 |
#3791 | Modern Strange Cowboy | 27 |
#3792 | giles.r.beebe | 27 |
#3793 | Zepptile | 27 |
#3794 | that silly lad | 27 |
#3795 | comellijoel8 | 27 |
#3796 | Pretérito mais que Perfeito | 27 |
#3797 | MaksymKsim | 27 |
#3798 | A Real Creative Name | 27 |
#3799 | D A V I [Versión Festivo] | 27 |
#3800 | Blurrywindmotor | 27 |
#3801 | Bisexual Femboy :3 | 27 |
#3802 | детка.. я хочу теб | 26 |
#3803 | Po | 26 |
#3804 | eZaF | 26 |
#3805 | Why have I | 26 |
#3806 | Kalavera | 26 |
#3807 | Igniz | 26 |
#3808 | Nandoca | 26 |
#3809 | ็็็็ | 26 |
#3810 | codorninha661 | 26 |
#3811 | BrookPagodeiro | 26 |
#3812 | vicho_flug | 26 |
#3813 | The Clown | 26 |
#3814 | piss >:D (Cuben) | 26 |
#3815 | ᛈᚨᚷᚨᚾ ᚲᛟᚹᛒᛟ | 26 |
#3816 | Ly | 26 |
#3817 | EDU4RD0 | 26 |
#3818 | woof | 26 |
#3819 | Bocchi | 26 |
#3820 | CRPMan | 26 |
#3821 | neoyenda | 26 |
#3822 | meowmeow | 26 |
#3823 | John McCain | 25 |
#3824 | Tezla | 25 |
#3825 | legi82026 | 25 |
#3826 | Inside the walls | 25 |
#3827 | tritoniramos | 25 |
#3828 | tf2_gamer | 25 |
#3829 | RlkDo22 | 25 |
#3830 | Im About To Poob | 25 |
#3831 | g7n | 25 |
#3832 | carlosfranca0502 | 25 |
#3833 | Verin | 25 |
#3834 | wL[1] | 25 |
#3835 | ⚡ Indigo Zap ⚡ | 25 |
#3836 | Feroms20125 | 25 |
#3837 | Chico Alicate | 25 |
#3838 | pencil | 25 |
#3839 | Wunderful | 24 |
#3840 | Headshot | 24 |
#3841 | ᵀғ ༒•AthØs•༒ | 24 |
#3842 | narcolepsy | 24 |
#3843 | Mixer276 | 24 |
#3844 | Limes314 | 24 |
#3845 | Mr. Cringe Man | 24 |
#3846 | warm | 24 |
#3847 | JUGGER | 24 |
#3848 | LiquidCat | 24 |
#3849 | ˣ | 24 |
#3850 | Isolineя | 24 |
#3851 | Blaham | 24 |
#3852 | k... | 24 |
#3853 | rose | 24 |
#3854 | ODRAP1RAKAHBTY | 24 |
#3855 | Tom_Nickle | 23 |
#3856 | Funky Barbarian | 23 |
#3857 | Keishosan | 23 |
#3858 | SlightGreen | 23 |
#3859 | THE FLAMES OF DISASTER | 23 |
#3860 | alej345 | 23 |
#3861 | Mario_roxo | 23 |
#3862 | Cold Circle | 23 |
#3863 | Beef | 23 |
#3864 | RS709 | 23 |
#3865 | Eli #adhd_gaming | 23 |
#3866 | energy_drive | 23 |
#3867 | TF2 Player One | 23 |
#3868 | CreadorDeLaPaja | 23 |
#3869 | cry | 23 |
#3870 | Lady Eragonti | 22 |
#3871 | Bart World no Mercy | 22 |
#3872 | woke dog | 22 |
#3873 | kye | 22 |
#3874 | Storefront | 22 |
#3875 | CavilhaBruno | 22 |
#3876 | SpiderDemonfrend | 22 |
#3877 | Pão com languiça | 22 |
#3878 | Pero Vaz de Caminha | 22 |
#3879 | Jacket The Chicken Man | 22 |
#3880 | +1 Cobain | 22 |
#3881 | Redeyedlion | 22 |
#3882 | Der JunkleShmunkle | 22 |
#3883 | porra games | 22 |
#3884 | wither | 21 |
#3885 | xmr bandit | 21 |
#3886 | Nen | 21 |
#3887 | lennyfaceplank | 21 |
#3888 | Atom4399 | 21 |
#3889 | Red Pikmin from Pikmin | 21 |
#3890 | Cloaker | 21 |
#3891 | SalDro | 21 |
#3892 | L00nyT00ny | 21 |
#3893 | cesarsantodomingodurann | 21 |
#3894 | Burrito Ortega | 21 |
#3895 | goblins arent real | 21 |
#3896 | Jao | 21 |
#3897 | DittoMaster6 | 21 |
#3898 | Pineapple | 21 |
#3899 | Hansov | 21 |
#3900 | tsukikku | 21 |
#3901 | R3o00 | 21 |
#3902 | GENEROSO | 21 |
#3903 | Angel the Eevee | 21 |
#3904 | FiFiNe | 21 |
#3905 | Peter | 21 |
#3906 | Francaff | 21 |
#3907 | m | 21 |
#3908 | Mata furros777 | 21 |
#3909 | h u s t l e p a r a d i s e | 21 |
#3910 | Dr Pepper | 21 |
#3911 | zhun | 21 |
#3912 | Jam | 21 |
#3913 | DOGAMY_2006 | 21 |
#3914 | Enoid | 20 |
#3915 | Chivo Respiratorio | 20 |
#3916 | jnstubbs84 | 20 |
#3917 | Totally Not A Bot | 20 |
#3918 | Bouncy | 20 |
#3919 | Loro o Pλpagλio | 20 |
#3920 | bênis | 20 |
#3921 | abroba | 20 |
#3922 | coojo2323 | 20 |
#3923 | J0KER | 20 |
#3924 | Kiwuu | 20 |
#3925 | bobert | 20 |
#3926 | uggug12 | 20 |
#3927 | La hermana de Milei | 20 |
#3928 | SCoiso | 20 |
#3929 | red knight | 20 |
#3930 | ryan goza e infarta 69 | 20 |
#3931 | blind_eye | 20 |
#3932 | Bubblez | 20 |
#3933 | Brotr0n | 20 |
#3934 | Bemmig | 20 |
#3935 | Tails | 20 |
#3936 | Kola007 | 20 |
#3937 | hunter | 20 |
#3938 | mixmastermax14 | 20 |
#3939 | Jolinha | 20 |
#3940 | WALL-E | 20 |
#3941 | Guys With Fries | 20 |
#3942 | senna | 20 |
#3943 | LukeFlySwatter | 20 |
#3944 | bookpro | 19 |
#3945 | Erwessa | 19 |
#3946 | Zacharia T. Wilson | 19 |
#3947 | tinglebrian.a | 19 |
#3948 | SpaceCokeCan | 19 |
#3949 | fgttgfftyrydfryd | 19 |
#3950 | vss | 19 |
#3951 | Zeta zeta zeta | 19 |
#3952 | ✞Leovich✞ | 19 |
#3953 | viictor | 19 |
#3954 | wolfwork001 | 19 |
#3955 | Mortarios | 19 |
#3956 | TrebTron64 | 19 |
#3957 | parpi | 19 |
#3958 | Guifranca | 19 |
#3959 | kauanmoreno50 | 19 |
#3960 | C0SM0S_4X | 19 |
#3961 | Indianafifer | 19 |
#3962 | Fancy | 19 |
#3963 | The Noid! | 19 |
#3964 | Leviathan | 19 |
#3965 | Bênio | 19 |
#3966 | robocop do governo | 19 |
#3967 | Juppydog | 19 |
#3968 | Leaf | 19 |
#3969 | NocturnalMafia94 | 19 |
#3970 | Dirty Harry | 19 |
#3971 | MG575838 | 18 |
#3972 | mathinho | 18 |
#3973 | Hamburgo "Hasan" Ahmood | 18 |
#3974 | Fear the beer | 18 |
#3975 | Jiro | 18 |
#3976 | Davizera | 18 |
#3977 | Ma Flodder | 18 |
#3978 | Henry | 18 |
#3979 | Elias | 18 |
#3980 | ★彡[ReoKazuma]彡★ | 18 |
#3981 | Silverspy442 | 18 |
#3982 | MR MADERIÑO | 18 |
#3983 | KrisN23rd | 18 |
#3984 | ex | 17 |
#3985 | rebz | 17 |
#3986 | CrispyItalian | 17 |
#3987 | Roberto Gómez Bolaños | 17 |
#3988 | ♡CinnaOwOll♡ | 17 |
#3989 | Brutus.Blackwater | 17 |
#3990 | SrKem | 17 |
#3991 | RedFlipFlop | 17 |
#3992 | Bulby | 17 |
#3993 | Olivia | 17 |
#3994 | Shotgun Engage | 17 |
#3995 | Brutedafoot | 17 |
#3996 | lucyway | 17 |
#3997 | fisheryolanda90 | 17 |
#3998 | saladadefruta | 17 |
#3999 | morte_cerebral42 | 17 |
#4000 | LELANDtheROMAN | 17 |
#4001 | Lemonade :3 | 17 |
#4002 | evil ai leaving scary message | 17 |
#4003 | zelitos | 17 |
#4004 | midrift | 17 |
#4005 | SpasticHooligan | 17 |
#4006 | Kype | 17 |
#4007 | ogochem | 17 |
#4008 | vjpalma85 | 17 |
#4009 | Sniper Gaming | 17 |
#4010 | lakaka99K(F2P) | 17 |
#4011 | Jimmy | 17 |
#4012 | human | 17 |
#4013 | egghead | 17 |
#4014 | Jmf blw.tf | 17 |
#4015 | V's Violent Votary | 17 |
#4016 | It´s a Mii | 17 |
#4017 | Foolscrow1 | 16 |
#4018 | ficion | 16 |
#4019 | Mister Frank | 16 |
#4020 | MAX COM TDAH | 16 |
#4021 | Riuk-23z | 16 |
#4022 | SheMixer005 | 16 |
#4023 | AlgoOriginal | 16 |
#4024 | jarate | 16 |
#4025 | RedFrog | 16 |
#4026 | pollo frito | 16 |
#4027 | sancheznavia.cristobal | 16 |
#4028 | firez | 16 |
#4029 | erik | 16 |
#4030 | average pootis engage enjoyer | 16 |
#4031 | JhongptJC | 16 |
#4032 | benre3 | 16 |
#4033 | ๊Nitraco | 16 |
#4034 | Heartland | 16 |
#4035 | Gabe GamePlays | 16 |
#4036 | Roman man SPa | 16 |
#4037 | Velcat | 15 |
#4038 | forkus | 15 |
#4039 | goober | 15 |
#4040 | Gonboi | 15 |
#4041 | brazilian surfista | 15 |
#4042 | ResetF | 15 |
#4043 | sei lá | 15 |
#4044 | Neoni76 | 15 |
#4045 | thedinoking117 | 15 |
#4046 | ReputablelyPlumpyAF:) | 15 |
#4047 | Orial | 15 |
#4048 | catcatcatcatcatcatcatcatcatcatc | 15 |
#4049 | +fGringaeD | 15 |
#4050 | McLovin | 15 |
#4051 | GATO MACONHA | 15 |
#4052 | some dumb cat | 15 |
#4053 | Mürphy. | 15 |
#4054 | Agus | 15 |
#4055 | ZERO | 15 |
#4056 | ♡El Don Emi♡ | 15 |
#4057 | D6 | 15 |
#4058 | OPsicólogo | 15 |
#4059 | Asqueroso_ | 15 |
#4060 | Pilot-45 | 15 |
#4061 | Still | 15 |
#4062 | FoxyZuw | 15 |
#4063 | marcinho | 15 |
#4064 | LonkS | 15 |
#4065 | pickroyboy | 15 |
#4066 | Voice_communicationOFF | 15 |
#4067 | Father Flaraty | 15 |
#4068 | Stolas <3 | 15 |
#4069 | The Peyote Cowboy | 15 |
#4070 | Goppy | 14 |
#4071 | mousejuggler | 14 |
#4072 | Henouki | 14 |
#4073 | AmazingOrange52 | 14 |
#4074 | PegaMacs | 14 |
#4075 | baseballmom67 | 14 |
#4076 | Onion #KillTF2 | 14 |
#4077 | gross incompetence | 14 |
#4078 | Skudler | 14 |
#4079 | _potatowizard_ | 14 |
#4080 | mid_gaming | 14 |
#4081 | Krev Dinn Krogen | 14 |
#4082 | starlone0 | 14 |
#4083 | FatMeatballman | 14 |
#4084 | tiagojdosantos | 14 |
#4085 | K1 | 14 |
#4086 | Okashii | 14 |
#4087 | daubalek | 14 |
#4088 | I Feel Sick | 14 |
#4089 | Curious Tiki | 14 |
#4090 | boisterd | 14 |
#4091 | ⋆ Strawberry G ⋆ | 14 |
#4092 | Kablindo | 14 |
#4093 | Toast | 14 |
#4094 | Slothmaster738 | 14 |
#4095 | Сынок | 14 |
#4096 | Pilot | 14 |
#4097 | UltimatePapyro | 14 |
#4098 | The_Mega_Force | 14 |
#4099 | The Ultimate Specimann | 14 |
#4100 | Jon Nödtveidt | 14 |
#4101 | minecraft | 14 |
#4102 | Cos | 14 |
#4103 | orange hat mann | 14 |
#4104 | [y] | 14 |
#4105 | mogo | 14 |
#4106 | The Black Steph Curry | 13 |
#4107 | atom | 13 |
#4108 | Amolestado games | 13 |
#4109 | eso brad | 13 |
#4110 | seven | 13 |
#4111 | M.á.t.é | 13 |
#4112 | una_vaca_rusa | 13 |
#4113 | TheOrangeJuiceLover123 | 13 |
#4114 | soy un mixero hediondo | 12 |
#4115 | Goober | 12 |
#4116 | PI RA CAN JU BA | 12 |
#4117 | RititoXan de aspecto dawi | 12 |
#4118 | EREBE | 12 |
#4119 | PepsiPyro! | 12 |
#4120 | raiden | 12 |
#4121 | Darthey | 12 |
#4122 | Charles Cheese | 12 |
#4123 | FXy | 12 |
#4124 | El Hiena | 12 |
#4125 | rensor87 | 12 |
#4126 | pasteleiro | 12 |
#4127 | jonpeter205 | 12 |
#4128 | chuffnuts10 | 12 |
#4129 | basedkingdom1337 | 12 |
#4130 | masrurkarimkhan1 | 12 |
#4131 | Goaty Goat | 12 |
#4132 | magna.barros | 12 |
#4133 | Korvus | 12 |
#4134 | Carlitos | 12 |
#4135 | OtavinhoF2P | 12 |
#4136 | n30ng0dboi | 12 |
#4137 | medic is suffering | 12 |
#4138 | Polkijuh | 12 |
#4139 | kgb_utk | 12 |
#4140 | TheGreatGorilla | 12 |
#4141 | luizito CONQUISTER | 12 |
#4142 | Triten | 12 |
#4143 | ezra | 12 |
#4144 | miguelvargasbebiano8 | 12 |
#4145 | Solid | 12 |
#4146 | Brandiux | 12 |
#4147 | fr3dm3rc0ry | 12 |
#4148 | Sam | 12 |
#4149 | rainbow | 11 |
#4150 | vinc | 11 |
#4151 | Coops | 11 |
#4152 | Lolla | 11 |
#4153 | rychard12_ | 11 |
#4154 | XxRichardxX | 11 |
#4155 | AGL Extreme UR Vegeta DF | 11 |
#4156 | .wolos | 11 |
#4157 | ElCukaLoca | 11 |
#4158 | ljwiltse | 11 |
#4159 | fatscout | 11 |
#4160 | Saiser | 11 |
#4161 | teo | 11 |
#4162 | Caelo | 11 |
#4163 | Alex | 11 |
#4164 | Monik | 11 |
#4165 | eepi_pen | 10 |
#4166 | Tesloche | 10 |
#4167 | Down Is The New Up | 10 |
#4168 | ᘛ⁐̤ᕐᐷ cheers | 10 |
#4169 | Emotional Assistant Demoman | 10 |
#4170 | Charoser | 10 |
#4171 | panacea | 10 |
#4172 | dustbowl tf2 | 10 |
#4173 | MaddSquabbles | 10 |
#4174 | bobestonja1 | 10 |
#4175 | BigManEthan | 10 |
#4176 | Pubert | 10 |
#4177 | Kratcher | 10 |
#4178 | Zetaroko | 10 |
#4179 | Writer | 10 |
#4180 | Ferroso | 10 |
#4181 | M,n,b | 10 |
#4182 | mario kart wii 150cc | 10 |
#4183 | force a nature enjoyer | 10 |
#4184 | gabriel | 10 |
#4185 | Nocream898 | 10 |
#4186 | Dragoz | 10 |
#4187 | Phill Connors | 10 |
#4188 | ciência_computer.05 | 10 |
#4189 | пес свастон | 10 |
#4190 | perro | 10 |
#4191 | Guido | 10 |
#4192 | conrado | 10 |
#4193 | FIRE CAT | 10 |
#4194 | aceverareid | 10 |
#4195 | tomi | 10 |
#4196 | iLoveMvM | 10 |
#4197 | LEO THA DEAL | 10 |
#4198 | Fernit | 10 |
#4199 | YaaY | 10 |
#4200 | Cortinotas | 10 |
#4201 | 4queijos | 10 |
#4202 | h77_ | 10 |
#4203 | dusty | 10 |
#4204 | Sharp | 10 |
#4205 | Кал Калыч | 10 |
#4206 | Catnap | 10 |
#4207 | A1ienOfDoom | 10 |
#4208 | Kim2429N | 10 |
#4209 | Freddy Mercury | 10 |
#4210 | Mackbad | 10 |
#4211 | Johw_Snow | 10 |
#4212 | arroz2346 | 10 |
#4213 | NokamiWD | 10 |
#4214 | Revolution | 10 |
#4215 | PoisoneneV | 10 |
#4216 | lkdsMENCIS | 10 |
#4217 | Vizzel_Ray | 10 |
#4218 | ᵍᵃʳᶠ | 10 |
#4219 | Mr. Foxtrot | 10 |
#4220 | ZuZu | 10 |
#4221 | livesniper89 | 10 |
#4222 | Houssam26 | 10 |
#4223 | Plush | 10 |
#4224 | Araina | 10 |
#4225 | o maníaco da frigideira | 10 |
#4226 | taco enjoyer | 10 |
#4227 | pyrethema | 10 |
#4228 | cratwar | 10 |
#4229 | Blueth | 10 |
#4230 | lecrazyboi | 10 |
#4231 | ジェイ | 10 |
#4232 | mr*pink | 10 |
#4233 | Sgt. Pinecone | 10 |
#4234 | NPC3D | 10 |
#4235 | pinhata | 10 |
#4236 | ElderlyGaming | 10 |
#4237 | Kristofkri | 10 |
#4238 | Emaciel Toquete | 10 |
#4239 | Dragon69 | 10 |
#4240 | t fokin odio dwjdwj | 10 |
#4241 | cakemaker141 | 10 |
#4242 | Rias | 10 |
#4243 | lobotomite | 9 |
#4244 | Skeeter | 9 |
#4245 | Right to Bear Shovels | 9 |
#4246 | XV1 | 9 |
#4247 | Phantom Lord | 9 |
#4248 | ТуРиСт | 9 |
#4249 | dr.cirolonga#TF2EASY | 9 |
#4250 | bublegumm | 9 |
#4251 | Casio | 9 |
#4252 | s0m30n34ccgm | 9 |
#4253 | Mr_Cat | 9 |
#4254 | Mogens | 9 |
#4255 | MisterB876 | 9 |
#4256 | Marvolo | 9 |
#4257 | LowerExpectations | 9 |
#4258 | coito | 9 |
#4259 | Jonathan | 9 |
#4260 | viktoriaw | 9 |
#4261 | silly noob | 9 |
#4262 | A Medic Main | 9 |
#4263 | ileus | 9 |
#4264 | yamtheman | 9 |
#4265 | ummm, i dont know :) | 9 |
#4266 | ¯\_(ツ)_/¯ | 9 |
#4267 | kyla.elizabeth777 | 9 |
#4268 | spy 100 days | 9 |
#4269 | Samurai Crente | 9 |
#4270 | Tuffinay | 9 |
#4271 | shootinmoney | 8 |
#4272 | Dorgão | 8 |
#4273 | Tizzer ☭ | 8 |
#4274 | The Killjoy | | 8 |
#4275 | BatmanMW | 8 |
#4276 | Terminal Prompt | 8 |
#4277 | hotsaucelover | 8 |
#4278 | Lukka | 8 |
#4279 | thekhanun | 8 |
#4280 | lamebot | 8 |
#4281 | Wicks | 8 |
#4282 | sievert | 7 |
#4283 | BRIANUUU | 7 |
#4284 | jim | 7 |
#4285 | Smurf_Corinthiano | 7 |
#4286 | ҉҉҉҉҉҉҉tera! | 7 |
#4287 | POOTIS.INC | 7 |
#4288 | cu | 7 |
#4289 | ratprince29 | 7 |
#4290 | zombictor | 7 |
#4291 | Ednaldo Pereira (real) | 7 |
#4292 | Casimiro-Gaming | 7 |
#4293 | mr pé | 7 |
#4294 | zino autista viado | 7 |
#4295 | Detective DickCock | 7 |
#4296 | 2fortfreak | 7 |
#4297 | Sinister invincible | 7 |
#4298 | Wednesday_Witch | 7 |
#4299 | Ultimate11 | 7 |
#4300 | SF Igor | 7 |
#4301 | Bruxocalvo71 | 7 |
#4302 | only normal spy | 7 |
#4303 | THEPUNISHER | 7 |
#4304 | run | 7 |
#4305 | BackShotWind | 7 |
#4306 | Butt Poopington | 7 |
#4307 | SrLuuucas | 7 |
#4308 | the hectic ANGRY gamer | 7 |
#4309 | PAULO BORRACHINHA | 7 |
#4310 | Calmer | 7 |
#4311 | Sleepy_Villager | 7 |
#4312 | code_016 | 7 |
#4313 | My Melody ♥ | 7 |
#4314 | Yennefer | 7 |
#4315 | Fran Fijap | 7 |
#4316 | Meggerroni | 7 |
#4317 | eduardotgp863 | 7 |
#4318 | Juliosts | 7 |
#4319 | roberta1997campos | 7 |
#4320 | jungle inferno lover | 7 |
#4321 | Dr.Josh | 7 |
#4322 | [LIVE] ttv/xholotv | 7 |
#4323 | AJW | 7 |
#4324 | Goober | 7 |
#4325 | bilau gigante | 7 |
#4326 | McHenBro123 | 7 |
#4327 | Xǐ Kђần 成为龙 | 7 |
#4328 | Serial Designation S | 7 |
#4329 | Exo Freestyle | 7 |
#4330 | iamajackalope | 7 |
#4331 | ✞ŽELEZOHREJ✞ | 7 |
#4332 | ryan.stapley | 7 |
#4333 | mini #FixTf2 | 7 |
#4334 | Kevim_mhamar55 | 7 |
#4335 | park | 7 |
#4336 | culiao que no sabe jugar | 7 |
#4337 | MEXANIK | 7 |
#4338 | Dell | 7 |
#4339 | Heartshine | 7 |
#4340 | Geinw | 7 |
#4341 | SNFLPFF123 | 7 |
#4342 | Funky | 7 |
#4343 | Vicioso | 7 |
#4344 | Carmasim | 7 |
#4345 | MateoTDFan | 7 |
#4346 | Kube | 7 |
#4347 | Ippo's sis | 7 |
#4348 | Ippo Makunouchi | 7 |
#4349 | smytt76 | 7 |
#4350 | canadadian | 7 |
#4351 | GUMMY BEAํR | 7 |
#4352 | GUMMY BEARํ | 7 |
#4353 | TF2isEASYPyroswag | 7 |
#4354 | ozturkahmet20111 | 7 |
#4355 | leonardofernandessousa155 | 7 |
#4356 | coolgamerboy78 | 7 |
#4357 | im-a-disgrace | 7 |
#4358 | TBE Industries | 7 |
#4359 | RJRunner | 7 |
#4360 | Bili | 7 |
#4361 | papinho de cria | 7 |
#4362 | IVE COME TO MAKE AN ANNOUNCEMEN | 7 |
#4363 | BrownieManStan | 7 |
#4364 | ⛧⸸☩✠MAMMON✠☩⸸⛧ | 7 |
#4365 | D3r3ck20 | 7 |
#4366 | ✙ STURM ✙ | 7 |
#4367 | Tanoshi | 7 |
#4368 | Kowalski | 7 |
#4369 | glauce_silvio | 7 |
#4370 | El_TT | 7 |
#4371 | Ultimate208 | 7 |
#4372 | HexesMekhane | 7 |
#4373 | Batyouone | 7 |
#4374 | -=[o.W.n]=- Pietro | 7 |
#4375 | sentry gun | 7 |
#4376 | NoSpookss | 7 |
#4377 | Lord Of Something | 7 |
#4378 | walter16wmay | 7 |
#4379 | MythHunterGT_YT | 7 |
#4380 | akiapachi135 | 7 |
#4381 | junk2holt | 7 |
#4382 | Sargento DF | 7 |
#4383 | 123456 | 7 |
#4384 | The Mighty Lord Noobius | 6 |
#4385 | Ellizabeth | 6 |
#4386 | symply | 6 |
#4387 | real black goku | 6 |
#4388 | Japa | 6 |
#4389 | Windows64xp | 6 |
#4390 | ari189 | 6 |
#4391 | Toffee Klim | 5 |
#4392 | freeyman81 | 5 |
#4393 | vacachimuela | 5 |
#4394 | CampinCarl | 5 |
#4395 | Blue | 5 |
#4396 | Armorey | 5 |
#4397 | kuruma | 5 |
#4398 | Velozter_Gameplais | 5 |
#4399 | Mr. Napoleon | 5 |
#4400 | Valdo | 5 |
#4401 | john direct | 5 |
#4402 | Jonas | 5 |
#4403 | [[DAVE 64]] | 5 |
#4404 | Mrlanzo1 | 5 |
#4405 | KevmonoInventor | 5 |
#4406 | Inverted Albino | 5 |
#4407 | MasterMind! | 5 |
#4408 | france piero | 5 |
#4409 | Zim#FixTF2 | 5 |
#4410 | Pizzä | 5 |
#4411 | Seth | 5 |
#4412 | flikune [aka a random 11 Y.O] | 5 |
#4413 | Zordiarim | 5 |
#4414 | Estanii | 5 |
#4415 | P.H.C | 5 |
#4416 | giofario101 | 5 |
#4417 | ShizamDa_Geek | 5 |
#4418 | Loviuz, your fellow creature | 5 |
#4419 | [S]teak | 5 |
#4420 | Mr. Solitude | 5 |
#4421 | Epic necromancer | 5 |
#4422 | HAZARD38RUS | 5 |
#4423 | aizen gaming | 5 |
#4424 | DigoBora | 5 |
#4425 | TAKKAR | 5 |
#4426 | Miauminas | 5 |
#4427 | DRGAMESX | 5 |
#4428 | Rin Hoshizora (Nya) | 5 |
#4429 | Tokage | 5 |
#4430 | moefang | 5 |
#4431 | SneakyMcGee | 5 |
#4432 | Serenity | 5 |
#4433 | dani. | 5 |
#4434 | that fucking annoying ass deer | 5 |
#4435 | swolmigs | 5 |
#4436 | Lc | 5 |
#4437 | RobinEsc | 5 |
#4438 | SHRNKVI | 5 |
#4439 | lUcKy LuKe | 5 |
#4440 | weidt | 5 |
#4441 | manolo reparaciones | 5 |
#4442 | nenetaistop2 | 5 |
#4443 | SrAxo | 5 |
#4444 | Refridgerator | 5 |
#4445 | saeyyur | 5 |
#4446 | superstank | 5 |
#4447 | Peppermint | 5 |
#4448 | The Boiled One Girl | 5 |
#4449 | Birb | 5 |
#4450 | The Jarate-Kid | 5 |
#4451 | LifeAquatic | 5 |
#4452 | awn suco de acerola | 5 |
#4453 | alfons0x | 5 |
#4454 | Flakes | 5 |
#4455 | Modern_Player | 5 |
#4456 | siddhartha_R | 5 |
#4457 | lembergdi | 5 |
#4458 | DocOfDeath | 5 |
#4459 | kim kekkonen | 5 |
#4460 | Gogflax | 5 |
#4461 | Cube | 5 |
#4462 | 7374616C696E | 5 |
#4463 | Engineer Gaming | 5 |
#4464 | sanguche de milanesa | 5 |
#4465 | manriflegaming | 5 |
#4466 | cyzk | 5 |
#4467 | Sussyfart131 | 5 |
#4468 | Ducky :) | 5 |
#4469 | ¡jbz! | 5 |
#4470 | kiito | 5 |
#4471 | Glendor | 5 |
#4472 | 금은다이아 | 5 |
#4473 | (1)GUMMY BEAํR | 5 |
#4474 | guestk800 | 5 |
#4475 | ThatOneStickFigure | 5 |
#4476 | kromare | 5 |
#4477 | stevebraun | 5 |
#4478 | bouzu1977 | 5 |
#4479 | GORE | 5 |
#4480 | maverick | 5 |
#4481 | Sannesa | 5 |
#4482 | People watcher | 5 |
#4483 | GoorgeGamin' | 5 |
#4484 | huntress | 5 |
#4485 | Canned | 5 |
#4486 | ColossalDreadnah | 5 |
#4487 | bee | 5 |
#4488 | pedrogustavo4953 | 5 |
#4489 | Sam the Kaiju Nerd | 5 |
#4490 | -=[o.W.n]=- katsudon | 5 |
#4491 | Degenerate Taco Meat | 5 |
#4492 | aleczanderagustin | 5 |
#4493 | Boss Mode | 5 |
#4494 | a.griffiths228 | 5 |
#4495 | Memori | 5 |
#4496 | bazziro69 | 5 |
#4497 | SKYWEEZ | 5 |
#4498 | GinSackay | 5 |
#4499 | jeff.atkinson85 | 5 |
#4500 | ☁Reggie☁ | 5 |
#4501 | PP | 5 |
#4502 | Goober | 5 |
#4503 | wayne the brain mcclain | 5 |
#4504 | Sr. Roswaal | 4 |
#4505 | lupusprimus97 | 4 |
#4506 | twitch.tv/yeschizoid | 4 |
#4507 | chulo | 4 |
#4508 | Juaovitoor | 4 |
#4509 | MRKELA | 4 |
#4510 | crespo_ | 4 |
#4511 | Ковалька | 4 |
#4512 | Léo753 | 4 |
#4513 | Wend 013 | 4 |
#4514 | most_useless_engineer | 4 |
#4515 | Friedensturm | 4 |
#4516 | MasterLegal48 | 4 |
#4517 | Yoda | 4 |
#4518 | Nhos10 | 3 |
#4519 | BruSantR | 3 |
#4520 | Marking | 3 |
#4521 | Mr Naranjo | 3 |
#4522 | Sigmar's Bestest Boy | 3 |
#4523 | nollie | 2 |
#4524 | Demezinho | 2 |
#4525 | thiagozin | 2 |
#4526 | Local shower shitter | 2 |
#4527 | elkkdo23 | 2 |
#4528 | aaron | 2 |
#4529 | EthanTheKnight | 2 |
#4530 | Sandwinch_Gaming | 2 |
#4531 | Patrick26 | 2 |
#4532 | NotDoesHotter | 2 |
#4533 | Jercof | 2 |
#4534 | cara de cachorro | 2 |
#4535 | Freeza | 2 |
#4536 | illan | 2 |
#4537 | Isac A Marmota | 2 |
#4538 | mishasos24 | 2 |
#4539 | john gyatt the rizzler | 2 |
#4540 | nice | 2 |
#4541 | keeekn | 2 |
#4542 | SniperNoSwiper | 2 |
#4543 | KiKi | 2 |
#4544 | Cam | 2 |
#4545 | CornHolio #fixtf2 | 2 |
#4546 | leandropinheirordgs | 2 |
#4547 | FEalter | 2 |
#4548 | Metal2310 | 2 |
#4549 | Hey It's me your STEP DAD | 2 |
#4550 | Lucasmx | 2 |
#4551 | daniel1010sh | 2 |
#4552 | reserva | 2 |
#4553 | tasmanw6 | 2 |
#4554 | lobotomeme | 2 |
#4555 | smithfam1111 | 2 |
#4556 | Blindtrip | 2 |
#4557 | beuwolfin | 2 |
#4558 | Monϵv | 2 |
#4559 | lya505 | 2 |
#4560 | bratatasemlata | 2 |
#4561 | :> | 2 |
#4562 | mata abuelas 1 | 2 |
#4563 | gareth bale gaming | 2 |
#4564 | Copyright! | 2 |
#4565 | a376frag | 2 |
#4566 | Jolly Roger | 2 |
#4567 | Penguinee | 2 |
#4568 | DenjiroXD | 2 |
#4569 | spikyo | 2 |